Dataset for CDS Unclassified of organism Pygocentrus nattereri

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B4CHC5_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pygocentrus nattereri (length=627 residues).
atggccagcaagaaggagaaggtgtacgacagccggcagatagtggagaagtatctgcaccacaagctggccaagagcgg
tcacgcgtgggaggaggaaggaggagaagagggagaggaggatgaagaagaagaaggaggaggaggagaggagaacaggg
tgcaccaggctccggcggccgtgcacggagcgctgagggaggcgggggacgagctggagcgcctgtatcagtccgatctg
accgagatggccgggcgcctggagctggagcccgcggtggcgagccggagcttcgcggcggtggccgacgagctgttccg
ggacgaggtgaactgggggcggatcgtggcgttcctggagttcggcgcggccgtgtgcgtggagcggcggcgagcggccg
agagcatcaccgccgacgtggcccgctggatgactgagtatctaaacgggccggttctgaagggatggatccgggacaac
ggaggatgggatgccttcgtggatctgaacggccggcagaaggagtcggttttcagcagttcctggccgtccatagtgag
cgtgttcagcctggcggcgctgggggccgtgggcttcaccataggagcgtatctcgctcagaaataa
>gnl|bcl2dbcds|A0A3B4ENK0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pygocentrus nattereri (length=711 residues).
atggccaatgaaagtccctacaacatccgggacatcgtggagagatacatccagcacaaacttctcaagcgaggctacgt
gtgggagttccgccccggcgccgccgccgccgccacggccgacgacgacgacaacgacgaggccgagatgccgcgcgcag
ggcccgcgaggctgcaccggttgctgcgcgaggccggcgatgagctcgagcgcgcctaccagcgggacttcgccgccatg
tgggaccagctgcgcgtggcgccgagcacgcagctccagcgcagcttcgtggccgtggccgaggagctgttcggcgacgg
cgtgaactggggccgcgtcgtggccttcttcgagttcggcggcaccctgtgcgtggagagcgtgaaccgcgagatggcgt
cgcaggtggaccacatctcgagctggatgaccgattacctgaacggaccactgctgcagagctggatccgggacaacggt
ggctgggatgcctttgtggagatctacagtcagcagagaaggtctattttccacccctggccctatctaaagacagtgtt
tggtctggcagccctgggggcagcagggcacttgttctctcagcatcgcactgccctgcccaggaccaaggctctactgt
ctactccatggagcggagctgtcctttgtccacatgcttgtgactggagcgggagaagaaacaaggattaa
© 1998-2019