Dataset for CDS BCL-2-like of organism Pygocentrus nattereri

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3B4C6H5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=669 residues).
ttattttcatttgtgtgggaattttctaggaaatggccatggaattttctttgggaaaaactgatcgcagctgttacaga
cggttctctaccaacgtcccccgcgtcggattgtgaggagttggactcagaccaattcaaggaatctgaaactttggaca
gagacacttcagaaatagtcattgactttttgcaaaacttcaccgggctgtctcggtcctgtggtcggcaccgtggggtt
gtacagacaataaggagggtggtggacggcctggtggtgaagcatgagctcgtctacaaaggtatgtttactaggctggg
tatggaagacagaggagatgacatgcatataattaggacagtggctaaggagctcttcagcgatggcatcaccaactggg
gtcgaatcgccagcctgctggcctttggtgcagtggtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagt
cttgtgggccaagagatttcctcatatcttctttcagaccaaaaagactggctactgaaaaataaagcatgggatggctt
tgtggagttttttcatgtcccggatcccgagtcaaaaatgaggaatgcattaatggccttggttactgcagcaggtgttg
gagcaggacttgttttattgtcaagataa
>gnl|bcl2dbcds|A0A3B4C6H5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=717 residues).
atgatgatgagtcccaaggagatgtattttgataagaagactgtttttccttctttgctggcgaagcgaccttttactct
gggtatatcctctcaaacccgggcgcccaggatcgcagctgttacagacggttctctaccaacgtcccccgcgtcggatt
gtgaggagttggactcagaccaattcaaggaatctgaaactttggacagagacacttcagaaatagtcattgactttttg
caaaacttcaccgggctgtctcggtcctgtggtcggcaccgtggggttgtacagacaataaggagggtggtggacggcct
ggtggtgaagcatgagctcgtctacaaaggtatgtttactaggctgggtatggaagacagaggagatgacatgcatataa
ttaggacagtggctaaggagctcttcagcgatggcatcaccaactggggtcgaatcgccagcctgctggcctttggtgca
gtggtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttgtgggccaagagatttcctcatatcttct
ttcagaccaaaaagactggctactgaaaaataaagcatgggatggctttgtggagttttttcatgtcccggatcccgagt
caaaaatgaggaatgcattaatggccttggttactgcagcaggtgttggagcaggacttgttttattgtcaagataa
>gnl|bcl2dbcds|A0A3B4CGU9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=729 residues).
atggagagcgccgccatcagcctgttctgtaacggagcggggaggatcccgttcaacaagggctcggagagccagctgga
ccgcccggaccggcccgaccgcggcctggagggactacaggcagcgcccggacccgctagcaaggccgccatggccggag
ggtcgctgcccgagtccccggagtccgacgacttcgtgcccgacttcggcggcagcgccctggtggaggagacccggcgg
ctcatcgggggcttttaccgcggatatatcggccagaagacccgggaccagcaccccgcccacggcacgatgagcagggt
ggtggagggggtgatcctcaagcacagcatcgcgtacaacggtatggtccagcgattgtgtttggagcagcaagacgata
gcatggagtttattagcagtgtggcgaagaccctgttcaatgatgggaccaccaactgggggcggattgccagtctggtg
gcgtttggtgcggtggtctgtgagcagatgaaggaagcaggcagagagcagtgtgtggagaacgtcatacaacacatctc
aacgtacctcagtacagaccagcgacagtggctcatcaacaacaaagcctggggaggttttgtggagttcttccgtgaag
acgactccgagtcacgcgtacggaacgctcttatggccttcgcgggattcgctggcctgggggcggggctagcactactg
atgcgctga
>gnl|bcl2dbcds|A0A3B4CGU9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=801 residues).
atggaagctcacggtggagttcagatcaacatggcagctcatcctggaggcagtatctgtgctccggttctccatggaag
ttcttttggaggtccagtcacactgatatacctcatacacggaggtcagggaggttccagttccagctcagctcagacgg
gttctcctgctgctcctgaactcactcacgtccaggtcaacagcattagcattagcagcaccaaggagcaaaccaccatc
agcctgtgtgacggagaggtgaccgtgctgattaaaccgaaaccaaagggccgagtcaggctggaggaggagaccctctg
catcatcggggatttttaccagggatacaggagccgaaaccagcacccagcctcggacacgctgagcagagtggtggagg
ggatgctccacaaacacagtgttgcctacagcggtatggtccagcgattgtgtttggagcagcaagacgatagcatggaa
tttattagcagcgtggcgaagaccctgtttgatgatgggatcaccaactgggggcggattgccagtctggtggcgttggg
tgcggtggtctgtgagtggctgaaggaggtgggcagagagcagtgtgtggagaacgtcatacaacacatctcaatgtacc
tcagtacagaccagcgacagtggctcatcaacaacaaagcctggggaggttttgtggagttcttccgtgaagacgactcc
gagtcacgcgtacggaacgctcttatggccttcgcgggattcgctggcctgggggcggggctagcactactgatgcgctg
a
>gnl|bcl2dbcds|A0A3B4DTL9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=BCL2L1 (length=717 residues).
atgtcttactacaacagagaactggttgtgtactttatcaagtacaaactctcccagaggaactatccctataaccacat
tgggcttatggaagacacaaatcggactgaagggggtcaggcggcagaggagaacgcagagggggcggcggtgacgccca
cggcagttgtcaacggatccgtaaatgggacaagtcacggtccagcggggtcgcccacctcttccccccaaagaaggtcc
aacggggccggagggctggacgccgtgaaggaagcactgcgggactcagccaacgagtttgagctgcgatattcacgcgc
ctttagcgacctctcctcccagctccatatcacgccagccacggcgtatcagagcttcgaaagcgtgatggacgaggtgt
tccgagacggcgtcaactggggccgtgttgtgggcctgttcgcgttcggtggggccctgtgcgtggagtgtgtggaaaag
gagatgagcccactcgtgggacgcatcgcagagtggatgactgtctacttggacaaccatatccagccctggatccagga
acaaggaggatgggagcgctttgcagagatctttgggaaggatgccgcagcagagagcagaaggtcacaggagaacttta
agaagtggctgctggcagggatgaccctggtcacaggggttgtggtgggctccctcatcgctcagaagcgtctgtaa
© 1998-2019