Dataset for CDS Unclassified of organism Pundamilia nyererei

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A0A3B4F099_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pundamilia nyererei (length=471 residues).
aactgttggtggctaagaaacagcacagggacatcgaaggccagctgtactgtgtggtgtgtggccaaaaaaaaggcacc
ccccatcacgtgggctgcccacacagatatccattgggcaacaccggccaatggaaaggaggcggacggggtcgccgacg
tggcaaagcagctgtttttggacgggtttgtaaactgggggcgtatagtgtgcttggtcgcatacggcgcggccttgtta
cgaagaccgaatgctgccgttagcgcgccgacatcggctcaagcccgcgggatcggcaacgccatagccgcacacataat
aaacgatcacatggattggtttgtggccaacagtggctgggtacgtcatgttatttttctattgaaccaggagtcgtact
cgctgccgagcggactgttgttcgtctgtggtattggattgtctctgttggcacttgcattgaaacaataa
>gnl|bcl2dbcds|A0A3B4GNW6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Pundamilia nyererei (length=681 residues).
atgtgccagatgatacactggtatgactggcaggagagatcgtggcatttgattagcctggccctgcagaggaggtccag
agtggagatgcagtgcaggaaccgagagctggtggagttctttataagctataaactgtctcagaagaatcacccaactt
cccttctgagtccaaccagtgtgggccaaaggactgagagagacctgggcaaatccctgcctgcgtacgttggcatagag
gctttaaaatcagctcttctagactcaggagagcagtttggttttctgttcacacagtcttttagggacgttgcttcaca
cctcaacatcacgccagacacagcccagcaatgcttcgagagtgtgatggaggagttgttcagggatggaatcaattggg
ggcgtataattggtctgtttgtctttggttctgcaatgtgtctggactgtattgacagcaatatgggtgagctggtaccc
gacattgcagactggatgactgcgtatctagatgatcacattagtctgtggatccaacgaaatggaggatgggaccgctt
tacagagatatttgggaaagggatgtctactaggagctctggggagtctctgaagagatggctatttgttggagtggcat
tagtaacagggctgctggttggcatgctcatgacagattaa
>gnl|bcl2dbcds|A0A3B4H3M3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pundamilia nyererei (length=597 residues).
atggccggcgcctacagcagccgggacctggtggaggacttcctgcgctacaagctgctcggcaggggcgtggcttggcc
tcagcgccaggccaatgacgagagagccccgcgtccagaccctcctgtggccccaccctgcctgcagaccgtgctgcgga
gcgccggcgacgagttggagcgactttacggcaacgaactgtctgcgcaggtgacggtgctgcaactgcgtgggagcggc
ggtggcgctgcacgccggcgccacctgacggctatcagagaggagctgttcagggatggcatgaactggggacgcatcgt
cgccatgatggagctgggcggagctctgagcgccgcggccgccaagtcgggcgacgaaggtcagatggacgatatcgcca
gctggatggaggagagtctggactcgccgtcgctccggagatggatccatgacaacggaggatgggatgcttttgtggag
ctgtatgagtccagacccaccgacagcttctggtccctgaggacagtgtgtggactggtcgtactgggagcagttggggt
catactgggatttctattcagccagaaacaaaactga
>gnl|bcl2dbcds|A0A3B4H829_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pundamilia nyererei (length=555 residues).
atgccacaaccgcggacctcagagcgcgtggtgagaccgtgctggctgaacatagacgcatcgggtccacgtgttatcgt
ctctgacgggttgagccaaagtgtccggcatctcaacgacccccccaccttcggatccggttggttggcagacgccgcgg
gcatgattcacatcgcagggtcgtacgacacgtacaaatgcgtagactgcaacatagtcttgtcgggatacaaaaaggcc
gacagaagcctaaacgagcacgtccttcgcatgctctcactgcagaccaccgccgccgctgaagtgtcaacggtcacacg
tgtggcacgcaccttgttttcagacggcattataaactgggggcgcatagtaagccttgtggcttacggcacagtgttac
tgcaagcgtcgaagtcaaccttgggacccgagtgctgtagcattggcgctccaccgccgctgcttttatactgcccttcg
cagggcccggtcggtgggtcggtcgggtctttctccgacccaccgaccgggcgcagtgttgtaacacttacttaa
© 1998-2019