Dataset for CDS BCL-2 of organism Pundamilia nyererei

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B4G3K4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pundamilia nyererei GN=BCL-2 (length=687 residues).
atggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcgggggttcgtgtggggatt
tcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggtgccgag
aagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgcaggcatc
cacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgca
tctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttattgctttcttcgagtttgggggcactgtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtggacaac
atcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatgggatgcatttgt
ggagctgtacgacagacagagggactccgtcttcagttgctcctggccctccatcaagacagttttcggcttggctgcgc
tcggagcggccagcctcaccatcggagcataccttacacaaaagtga
© 1998-2019