Dataset for CDS MCL-1 of organism Propithecus coquereli

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2K6F6N9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=411 residues).
gatctgtggattaacctggggatcagctgcgggcgggcagatctaggctgggcctggctgggtttgaaggccttccaagg
catgcttcagaaactggacatcaaaaacgaagacgatgtcaaatctttatcacgagtgatggtccatgttttcagtgaca
gcgtaacaaactggggcaggattgtgactttaatttctttttgtgcctttgtgtccaaacacttgaagaccataaaccaa
gagagctgcatcgaaccattagcagaaagtatcacagacattcttgtaaggacgaaacgagactggctattcttccatgt
agaagacctggaaggcagcatcagaaatgtgctgctggcttttgctggtgttgctggagtaggagctggtttgacttatc
taataagatag
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagacg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgcggccggct
cccattggtgccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacccgccgcgcattgcc
gtccgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccagcacggacgggtcacta
ccctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagacg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgcggccggct
cccattggtgccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacccgccgcgcattgcc
gtccgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccagcacggacgggtcacta
ccctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
© 1998-2018