Dataset for CDS BCL-2 of organism Propithecus coquereli

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K6G3I7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL-2 (length=705 residues).
atggcgcacgccgggagaacagggtatgataaccgggagatagtgatgaagtacatccattataagctggcgcagagggg
ctacgagtgggatgccggagacgcgggcgctgcgcccccgggggccgcccccacgccgggcatcttctcctcccagcccg
ggcgcaacccccctcccgctgcgcctcgggacccggccgccaggacctcgcccccgcccgccgccgccgcggggcctgcg
cccagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccgcgactt
cgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggataa
cggaggctgggacgcctttgtggaattgtatggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaga
ctctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
© 1998-2018