Dataset for CDS BCL2L10 of organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2NN92_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pongo abelii GN=BCL2L10 (length=615 residues).
atggttgaccagttgcgggagcgcactatcacggccgacctgctgagggagcgcaccgagcggctgctggccgactacct
ggggtgctgcgcccgggaacccggcaccccagagccgacgccgcccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagctccaccggtccttcttctccgcctacctcggctaccccgggaaccgcgtcgaactggtggcgctg
atggcggattccgtgctctccgacagccccagccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccccttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
© 1998-2018