Dataset for CDS BCL-2-like of organism Poecilia reticulata

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3P9N9Y4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactatctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgccagggacgcggccggggacggggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcgtcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggagtgtgtggagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacctggatgagcggattgaaccttgggtggagagccaaggaggatgggagcgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagcgtggtgacggccttcatagccgggtccatctttgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3P9NE65_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L10 (length=651 residues).
atgcgccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggctgtcgcagaggattacatccacctgcgctgctcaaacccacacccagcccctccacctccca
gcgagccggccgccgccatgaggcgcctggcccaggacgtggaggcccagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggacggatctctgctccaacctcagaaaggtgatggatgagatggtgggagatggacactt
taactgggggagggtggtgtccctcttcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggggccggactccgggaagcagcaggaactgcaacaagagaccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaagactggctgcaggaaaataatggatgggacgggttttgtagctatgccctcaatgccag
agaagtaagtcaggactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgctgggctcaccttccttc
tggtgcgctag
>gnl|bcl2dbcds|A0A3P9Q4R7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia reticulata GN=MCL-1 (length=831 residues).
atgacggctaattcgacaaccgcgttaaactatctcattttttcacaaaatggagtcgggaatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggctcccgtgtagaatctcttcattcgcctatggatcccttcaagaaac
gcccgacgaatcttgcagtgactgcatcgaatggatatgttgcaaaaagcctcccggagagcagcgacgacagcgacgaa
ggctctctgccatgcaccccggcgcagcaagacggtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaacggagcttattagcagttttctaagaaattttactggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcagcaagctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagagtctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgtagtgtgtcagcacctgaaggagaggggcagagagcactgcgtgg
atctggtgagccaggaaatatccacgtatctcctggcaaagcagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagaccctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcaggtga
>gnl|bcl2dbcds|A0A3P9Q4R7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia reticulata GN=MCL-1 (length=834 residues).
atgacggctaattcgacaaccgcgttaaactatctcattttttcacaaaatggagtcgggaatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggctcccgtgtagaatctcttcattcgcctatggatcccttcaagaaac
gcccgacgaatcttgcagtgactgcatcgaatggatatgttgcaaaaagcctcccggagagcagcgacgacagcgacgaa
ggctctctgccatgcaccccggcgcagcaagacggtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaacggagcttattagcagttttctaagaaattttactggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcagcaagctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagagtctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgtagtgtgtcagcacctgaaggagaggggcagagagcactgcgtgg
atctggtgagccaggaaatatccacgtatctcctggcaaagcagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagaccctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcagcaagtaa
>gnl|bcl2dbcds|A0A3P9QFB3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L1 (length=654 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggacggggacagccggggccctagcaatggcccgctggtcaacagcc
gggctggctcccgggggaagtcccagggccctcccgtcgaggtcgtcaaatcggttctgaaggacgcggcagaggagttt
gaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccacagcttcaa
gaccgtgctggatgagttgttcaagggcgaggtcaactggggtcgggtggtggccatgtttacctttggggggattctgt
gtgtggactgcgtccagaagaatatgagcgagctggtctcccgcattgctgaatggatgaccacttacttggacgagcag
ctcaatccctggatccagagccagggaggatgggaccacttcgctaacctgtacggccaggacgccgctgcagagggccg
gaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgtttatcg
ctaagaaacgatga
© 1998-2019