Dataset for CDS Unclassified of organism Poecilia formosa

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A087YSS6_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Poecilia formosa (length=585 residues).
atggcgaacgactacaatcgcaatattgtggaaaactacatctgccataaactctccaaacggggatacgtgtggggatt
taacggagtcccggacgacgacgctgctaacaacggaggtttaggtgaccattcaccgactttggttcggcgctgccgcg
atgcaggaccggggcccgacagcgacagcgacccccaccgcctctgcaggcggatctcgcagtccgacccgtacgcagac
atccaccgggtcctgcgcgacgccggtgacgaactcgagaaactgtaccagttggacttcgtggagatgtcgcagcagct
gtacctcaccagagacacggcgaggacgaggttcgccgaggtcataaacgaactgttccgggacggcgtgaactggggtc
ggattatcgctttcttcgagttcggaagcacggtgtgcgtggagtgcgcgtccaaagaggagatgacatcgcaagtggac
aacatcgcggagtggatgacggaatatttaaatggaccccttgacagctggatacaagataacgggggatggcctcttaa
gcgctttgcagatttgttgcaacgg
>gnl|bcl2dbcds|A0A087YSS6_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Poecilia formosa (length=690 residues).
atggcgaacgactacaatcgcaatattgtggaaaactacatctgccataaactctccaaacggggatacgtgtggggatt
taacggagtcccggacgacgacgctgctaacaacggaggtttaggtgaccattcaccgactttggttcggcgctgccgcg
atgcaggaccggggcccgacagcgacagcgacccccaccgcctctgcaggcggatctcgcagtccgacccgtacgcagac
atccaccgggtcctgcgcgacgccggtgacgaactcgagaaactgtaccagttggacttcgtggagatgtcgcagcagct
gtacctcaccagagacacggcgaggacgaggttcgccgaggtcataaacgaactgttccgggacggcgtgaactggggtc
ggattatcgctttcttcgagttcggaagcacggtgtgcgtggagtgcgcgtccaaagaggagatgacatcgcaagtggac
aacatcgcggagtggatgacggaatatttaaatggaccccttgacagctggatacaagataacgggggatgggatgcatt
tgtggaactgtacgacagacaaaaggagtcggtcttcagctgctactggccgtccatcaagactgtctttggtctggctg
cactcggagcggccagcgtcaccatcggagcgtaccttgcacaaaagtga
© 1998-2018