Dataset for CDS Unclassified of organism Petromyzon marinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|S4RB20_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Petromyzon marinus (length=435 residues).
gtccagagggcgatgagggcgagcggggacgagttcgagaggcgctacaggagcgccttcgcacagctgcccgcccaact
gcaggtcagccaggccacgctgagggcccgcttctccgacgtgctggacgagctcttcagagacggcgtcaactggggcc
gcgtggtcgccttcttcgccttcggcggggcgttgtgcgccgagtgcgtggacaaggagctgcccggcctggtgagcagc
gtcgccacgtggatgacctcctacctggaggaccgactgctgtggtggatcgacgataacggcggatggaaggctttgat
ttatgttgcccctacccacctttattttttttccttcgtctggagttcattgtgtcttaaaaatgtaaaactgcacggat
attgtaactcattaatgaatttgctaccggcagca
© 1998-2018