Dataset for CDS BCL-2-like of organism Periophthalmus magnuspinnatus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A3B3ZN55_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=645 residues).
atgtccctcaacagagaactggtggaattctacatccagtacaaactgtctcagcgggactgtcctctggggctggagga
tggtacggagattgacacagagagagacagggaccttctgggactgggggacaggagcgtggacaggaactccaccccct
cacttagactcagacttgactccgcctctgattctgcccccgctcttcgtgactccgctaatgagttcgagctccgtttt
agccgcgctttcagcgacctgcaccgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgtcatgga
cgaagtgttccgcgatggcgttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggagtgtg
tggacaaagagatgagcaccctagtggctcgcatcgtcacctggatgactgtgtatctggacgaacacatccaagactgg
atcgactcgcaagggggatgggcccgtttcgcagagatctacgggcaggacgccgccgcgcagagccgccattccgaaga
acgcttcaagaaatggctttttgccggaatgaccctggtcaccggggtcgtggtggggtcactgctcgcccagagacgcc
tgtga
>gnl|bcl2dbcds|A0A3B3ZN55_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=708 residues).
atgtccctcaacagagaactggtggaattctacatccagtacaaactgtctcagcgggactgtcctctgcagcacctggg
gctgggggacaggagcacacagagtgacacggagcatcttggacttggggataggggcgtagacagggctcggctgcaga
gagaaacagaggtggacagtacggaactcagacttgactccgcctctgattctgcccccgtccacagccccgcccccttg
ttggacctggacgccgttaaagaggctcttcgtgactccgctaatgagttcgagctccgttttagccgcgctttcagcga
cctgcaccgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgtcatggacgaagtgttccgcgatg
gcgttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggagtgtgtggacaaagagatgagc
accctagtggctcgcatcgtcacctggatgactgtgtatctggacgaacacatccaagactggatcgactcgcaaggggg
atgggcccgtttcgcagagatctacgggcaggacgccgccgcgcagagccgccattccgaagaacgcttcaagaaatggc
tttttgccggaatgaccctggtcaccggggtcgtggtggggtcactgctcgcccagagacgcctgtga
>gnl|bcl2dbcds|A0A3B4A3G8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL-2 (length=660 residues).
atggcgaacgactgcaatcgcaatattgtggaaaagtacatttgccataaactctccaaacgtggcttcgcgtggggttt
tcacgaggacgcagaggatgaaggagacgtggccaataacggttcgatagttgcatcttctccggttctggtgaaccgtc
ggtgccgcgcagagcggctctgttccgctccgtccgacccacacgcggccatccacagagtcctgcgcgaggctggagat
gaacttgagcggctgtaccagcccgacttcaccgagatgtccagacagctgtatctgacatcctcaacggcgcagaggag
gttcgcggaggttatagacgaactgttccgcgatggagtgaactggggcaggattattgcgtttttcgagtttggtggaa
ccgtgtgcgtggagtgcgcgtccaaagaggacatgtcatcccaagtggacaacatcgcagactggatgacggagtatttg
aatggaactctcagcagctggatccaagacaacgggggatgggaagcctttgtggagctgtacgatcgccagagggactc
ggtcttctcctgctcttggccgtccatcaaaaccgtgttcggattagctgctatcggagcggcgagcctgaccatcggcg
cgtacctgtcgcagaagtga
>gnl|bcl2dbcds|A0A3B4AAV4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L10 (length=585 residues).
atgtcgtgtgggctgtggaaagagaccttggctctggcagaggactacctgagcctgtgctgcagcggcccacaggcagc
tcctccacctcccagcgggtcagcctctgccatgaggcgcctgggccaggacatggaggcccagcacaaggcacgcttcc
actctctgagccagaccttcctcaagcagtgtgggccggacccctgctccagtctccggaaggtcatggaggagctggtg
ggagatggacacttgaactggggaagggttgtgtcccttttcacctttgctggggtgctggccagacacataaaagagca
gaagagtagcagaccagggctggaccctggacaagttcaaggtttgggacaggtgccctcagactgcaggcggctggcac
aaactatagctgattacttgggggaagagaagagggactggctgttggaaaacggtggctgggtaggcttctgtgagttc
tcctgtcatgccaggaaggtggaccaggactcgtcgatgaagaccgctctgtttgctgctgctggggtgggtttagctgg
gcttacctttctcttggtgcgctag
>gnl|bcl2dbcds|A0A3B4AFB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=MCL-1 (length=741 residues).
gacaccacatgcctacagggtgtgctaactccaccgcttggcacagcccacatttgcggctctcctcatccacgacccac
agctcttgtaatgaaaaacgaacttttaaataagaacacgcgagaagaggattacgaaaactcagaggggtctctgccat
gtacgccagaattccactcagacagtgaaatggagctctccagctactcggcggagcacgaagtgttagagagcgacacg
aggcagcttcttagcgattttttcaagcttttcacggggatttctcagccgaagtggaaacaacgtccggccctatctac
aatgaagggagttgtggacaagcttttggaaaagcacagatacgcatataatggtatgataaacaaactggctctggacg
acaggggggacgacgtatcgtttattggcacagtagccaagagtatctttgaagatggtaccactaactggggtcgtatt
gccagccttatagcctttggggctgtggtgtgccagtacctcaagacaaaaggaagagaaagctgtgtggagcgagtggg
ccaagaaatttcctcatacctcctgttggaccaacgagactggctagtcaggaataatgcctgggatggctttgtcgact
tcttcagagtagaagacccagagtcagcagtgaggaacacgcttatggctgtagctggattagctggtattggtgcaacg
ctggccatgttgatcaggtga
>gnl|bcl2dbcds|A0A3B4AFB7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=MCL-1 (length=858 residues).
atgaatattattaattctccgaagaggaccgcgttaaaactgtccaccatgggcttgtttctgcctcaaaatggactcgc
ggagggggacatgcactgtggggctgcagattcttccgcgcagatgcctaggcctgcaactatggacactcgtaaaggga
atacggcctccagcggctctcctcatccacgacccacagctcttgtaatgaaaaacgaacttttaaataagaacacgcga
gaagaggattacgaaaactcagaggggtctctgccatgtacgccagaattccactcagacagtgaaatggagctctccag
ctactcggcggagcacgaagtgttagagagcgacacgaggcagcttcttagcgattttttcaagcttttcacggggattt
ctcagccgaagtggaaacaacgtccggccctatctacaatgaagggagttgtggacaagcttttggaaaagcacagatac
gcatataatggtatgataaacaaactggctctggacgacaggggggacgacgtatcgtttattggcacagtagccaagag
tatctttgaagatggtaccactaactggggtcgtattgccagccttatagcctttggggctgtggtgtgccagtacctca
agacaaaaggaagagaaagctgtgtggagcgagtgggccaagaaatttcctcatacctcctgttggaccaacgagactgg
ctagtcaggaataatgcctgggatggctttgtcgacttcttcagagtagaagacccagagtcagcagtgaggaacacgct
tatggctgtagctggattagctggtattggtgcaacgctggccatgttgatcaggtga
>gnl|bcl2dbcds|A0A3B4BFZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=657 residues).
atgtctcccagtaaccgagagctggttgaattcttcataagctacaaattatcacagaaaaactacccaagttcgctgct
tatgtcagaccccgctagggtccagtgtgagggcaacaaggcagctaatgtcccgaatggtatgctaacaaaccggaatg
gcaacagacaaacactggcctcactgcctcctgatgatcacttagacgctattaagactgctctgacggactctgcagat
gaatttgaagagttgttcacacaagcattcagcaacctttcctctcagctcgacatcacacctgatacagcttataacag
ctttaaaagtgtcatggacgaggtgttcaaagatggggttaattggggacggattgtgggtctttttgtttttggagggg
ttttgagtgtggagtgtgtggagaaggatatgagcattctggttcctcgcattgctaactggatgactatctacctggat
gagaatatcgccacgtggattcaaaaccagggaggctgggccagctttgctcaaatttttgggcagaatgcagcaggaga
ggccagaaggtcccgagagactctgaagaaatggctgctagttggagtagggttgctagctggagtgctggttgctatgc
tcattgctaagaaatag
© 1998-2019