Dataset for CDS BCL2L1 of organism Periophthalmus magnuspinnatus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3B3ZN55_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=645 residues).
atgtccctcaacagagaactggtggaattctacatccagtacaaactgtctcagcgggactgtcctctggggctggagga
tggtacggagattgacacagagagagacagggaccttctgggactgggggacaggagcgtggacaggaactccaccccct
cacttagactcagacttgactccgcctctgattctgcccccgctcttcgtgactccgctaatgagttcgagctccgtttt
agccgcgctttcagcgacctgcaccgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgtcatgga
cgaagtgttccgcgatggcgttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggagtgtg
tggacaaagagatgagcaccctagtggctcgcatcgtcacctggatgactgtgtatctggacgaacacatccaagactgg
atcgactcgcaagggggatgggcccgtttcgcagagatctacgggcaggacgccgccgcgcagagccgccattccgaaga
acgcttcaagaaatggctttttgccggaatgaccctggtcaccggggtcgtggtggggtcactgctcgcccagagacgcc
tgtga
>gnl|bcl2dbcds|A0A3B3ZN55_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=708 residues).
atgtccctcaacagagaactggtggaattctacatccagtacaaactgtctcagcgggactgtcctctgcagcacctggg
gctgggggacaggagcacacagagtgacacggagcatcttggacttggggataggggcgtagacagggctcggctgcaga
gagaaacagaggtggacagtacggaactcagacttgactccgcctctgattctgcccccgtccacagccccgcccccttg
ttggacctggacgccgttaaagaggctcttcgtgactccgctaatgagttcgagctccgttttagccgcgctttcagcga
cctgcaccgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgtcatggacgaagtgttccgcgatg
gcgttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggagtgtgtggacaaagagatgagc
accctagtggctcgcatcgtcacctggatgactgtgtatctggacgaacacatccaagactggatcgactcgcaaggggg
atgggcccgtttcgcagagatctacgggcaggacgccgccgcgcagagccgccattccgaagaacgcttcaagaaatggc
tttttgccggaatgaccctggtcaccggggtcgtggtggggtcactgctcgcccagagacgcctgtga
>gnl|bcl2dbcds|A0A3B4BFZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=657 residues).
atgtctcccagtaaccgagagctggttgaattcttcataagctacaaattatcacagaaaaactacccaagttcgctgct
tatgtcagaccccgctagggtccagtgtgagggcaacaaggcagctaatgtcccgaatggtatgctaacaaaccggaatg
gcaacagacaaacactggcctcactgcctcctgatgatcacttagacgctattaagactgctctgacggactctgcagat
gaatttgaagagttgttcacacaagcattcagcaacctttcctctcagctcgacatcacacctgatacagcttataacag
ctttaaaagtgtcatggacgaggtgttcaaagatggggttaattggggacggattgtgggtctttttgtttttggagggg
ttttgagtgtggagtgtgtggagaaggatatgagcattctggttcctcgcattgctaactggatgactatctacctggat
gagaatatcgccacgtggattcaaaaccagggaggctgggccagctttgctcaaatttttgggcagaatgcagcaggaga
ggccagaaggtcccgagagactctgaagaaatggctgctagttggagtagggttgctagctggagtgctggttgctatgc
tcattgctaagaaatag
© 1998-2019