Dataset for CDS Unclassified of organism Penaeus vannamei

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A411IAT4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Penaeus vannamei (length=357 residues).
atggcagaaaaggtcaacatggcttctattaacatggaaaactttttctctctttgtggggaactgtttcatggtggaat
cacaagagagcgaattgtggccctgttcacctttgtaggggatgttgctgtgcaccaagtgagacaccgtggagaacagt
tcctcagtgtgctgctcaagtggtcatttagatacctggttgaccacatttgcaagtgggtccaggaggctggtggctgg
ggggtggtgctgaaccagggtatgaattttatctacaaaagtgtcgtgttcatgtgctgccttgttggaacagttgctgg
tggagtctacatatggaaatctctcaaggaaatgtaa
© 1998-2019