Dataset for CDS BCL2A1 of organism Pelodiscus sinensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|K7G130_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL2A1 (length=528 residues).
atggaaagttctgagttccgctatgtttactatttagtccaggattatctgaaatacattcttcaggaacctgagcttgg
accagccccaagcagagttgctcatgtcttaagaaattctgcatcttttcttcaaaaagaaaacgaagagatactgaaac
catgtttggacacacttgatattacctctgtagatgctgccagaagaattttcattcaagtcatggataaagaatttgat
gatggaaacactaactgggggcggattttgacaatatttatgtttggaggaattctttctaagaggcttcaagaacacaa
agttcagcttacaggagataataaagagcagatttcttatttcatcacggagtacattataaacaccaaggctgaatgga
tagatgcaaatggaggctgggaaaacggcttcctacctatgtttgaagaaaaacaatcgtggctgtcattattcaacatt
aaagcaaaaatcatggatgctttttccttcttcagtcagtattattga
© 1998-2018