Dataset for CDS Unclassified of organism Paramormyrops kingsleyae

[Download (right click)]

9 sequence(s)

>gnl|bcl2dbcds|A0A3B3Q8Q8_uncBCL2A1-02 Putative BCL2-related protein A1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=735 residues).
atgggaatgttgaaatttgcgtgtgcagctggagtgatggctgcggccgccggcacagcgtacctctaccggcggttcag
gaaaacgccagagcaggaggaagtgaatatggccacctcattgagggacgaaacccttatggtggcaaacgactatatgg
acttctgcattgggatcaagaggacacctcccagcgagtcagctaaagccatgcgatacatggcaaaggaggtggagaag
gagtatgagttcagactgcgccgtcttgtgcggtttttcttcatcaccagtggctttaacacctggactgaactcaagaa
tgtgatgctggaaatggttggtcatgaaagtatgagctggagccagattgttactctattcgccttcacgggaatactgg
cagttcaactttctaacgtagatgaagacgttgcctgcagcagacggctagcagaaatgattactgatgttcttcttgga
gaaaaagaagaatggattatccagaatggaggctggagggggttcgtggactatgtccacacagccaaaccagggtatcc
agattctcctgtgaagagagctctccttgcagctgcaaatgtgacaattgcctttcttcttgtacgttacagtatttcct
ttccatgttattcagagaaatgttttcctgaaagatttttgatcaagtttttcttaatttatgtacatatggttcactgt
tgtttcccccatgac
>gnl|bcl2dbcds|A0A3B3Q8Q8_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=606 residues).
atgggaatgttgaaatttgcgtgtgcagctggagtgatggctgcggccgccggcacagcgtacctctaccggcggttcag
gaaaacgccagagcaggaggaagtgaatatggccacctcattgagggacgaaacccttatggtggcaaacgactatatgg
acttctgcattgggatcaagaggacacctcccagcgagtcagctaaagccatgcgatacatggcaaaggaggtggagaag
gagtatgagttcagactgcgccgtcttgtgcggtttttcttcatcaccagtggctttaacacctggactgaactcaagaa
tgtgatgctggaaatggttggtcatgaaagtatgagctggagccagattgttactctattcgccttcacgggaatactgg
cagttcaactttctaacgtagatgaagacgttgcctgcagcagacggctagcagaaatgattactgatgttcttcttgga
gaaaaagaagaatggattatccagaatggaggctggatcagttatctgctaaaaagaaccctaccaggcttggtcccctc
agcaatggtaatcttcaagaaactgccaggaacatcaattagctag
>gnl|bcl2dbcds|A0A3B3QFC9_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=819 residues).
atggaaagctgcgagtttctttcgcgtttctgggaggggaaaatgtcctgctggttgtcgaaggagacattggtgctggc
agaagattacttggaattctgcgttggagtgcagcggacgccgcccggcccggcctcagaagcaatgcgctgcttggcca
aggagattgagaagcagaacctgtccaaatttcactcccttgtgcaaacttttctggactcttgtggaccggaccgtagc
agcagtttgagaaaggtgatggcagagatggtaggggatggaaaattaaactgggggagagtggtatccctctttgcgtt
caccggagtgctggtgggcgagctccattcccgaggggaagggaaggactgctgcaggagactggcggagacgatagccg
actacctgggggtggagaaacaagactggctgttgcaaaatgaaggatgggacggattctgcaagttttttcacagctca
agaggacaaaatcacgagtcagccatgaagacggcgctgttcgccgctgccgggagtgagaacatccggaggatcctgtt
tcatccactgcaggtgccctccagtggcagcgcctgccttagggcaccgttgcccaaacagcctttcaaaatcatgacgc
atgttctgtgtctagaaccagaacgacgtgttttgtccggactgcagggattcgagggcatggtaatttcagatgcctca
gccgtcgcccggggaacagcccagattaagagccacacacggataactgtcagcagcagaggcacacgggcctactattt
taacccaaacaaattttag
>gnl|bcl2dbcds|A0A3B3QFC9_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=651 residues).
atggaaagctgcgagtttctttcgcgtttctgggaggggaaaatgtcctgctggttgtcgaaggagacattggtgctggc
agaagattacttggaattctgcgttggagtgcagcggacgccgcccggcccggcctcagaagcaatgcgctgcttggcca
aggagattgagaagcagaacctgtccaaatttcactcccttgtgcaaacttttctggactcttgtggaccggaccgtagc
agcagtttgagaaaggtgatggcagagatggtaggggatggaaaattaaactgggggagagtggtatccctctttgcgtt
caccggagtgctggtgggcgagctccattcccgaggggaagggaaggactgctgcaggagactggcggagacgatagccg
actacctgggggtggagaaacaagactggctgttgcaaaatgaaggatgggacggattctgcaagttttttcacagctca
agaggacaaaatcacgagtcagccatgaagacggcgctgttcgccgctgccggggactatccactttcagccgtgggaga
accgcagcaccgatgctctctggcttcaggtcatggtggctccagttccggcatgttgcgcattgctgctgattcccacg
taatcaagtga
>gnl|bcl2dbcds|A0A3B3QFC9_uncMCL1-03 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=570 residues).
atggaaagctgcgagtttctttcgcgtttctgggaggggaaaatgtcctgctggttgtcgaaggagacattggtgctggc
agaagattacttggaattctgcgttggagtgcagcggacgccgcccggcccggcctcagaagcaatgcgctgcttggcca
aggagattgagaagcagaacctgtccaaatttcactcccttgtgcaaacttttctggactcttgtggaccggaccgtagc
agcagtttgagaaaggtgatggcagagatggtaggggatggaaaattaaactgggggagagtggtatccctctttgcgtt
caccggagtgctggtgggcgagctccattcccgaggggaagggaaggactgctgcaggagactggcggagacgatagccg
actacctgggggtggagaaacaagactggctgttgcaaaatgaaggatgggacggattctgcaagttttttcacagctca
agaggacaaaatcacgagtcagccatgaagacggcgctgttcgccgctgccgggattgacaggatgaaaaccaggctgtg
tgtgtggtaa
>gnl|bcl2dbcds|A0A3B3RFU8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=660 residues).
atggcaaatcaaagtacttttgatagtaggattatagtggagaattacatccaccaaaaactttcgaataggggaatcga
ctggggaatggactttggcgaggagacggagccgccagcgaacggctccacggacacggcgctctcacggcgactccaga
caggtgccgccgccgcccctattcgcagtcagacgacgcagtcggacccgcacgccgctcttcacgcagtcctgcgggaa
gctggggatcaggtggaaaggcgctaccgccgggacctggtggagatgtcggcgcggctgcacttgacacccgacacgac
ggagagcaagttcgccgcggtgatagaggagctgttcagggacggcaccaactggggccggatagtagccttcttcgagt
tcggggtagcggtgtgtgtcgagagcgtgaaccgggaaatgacgtcccaggtggaccacattgccaactggatgacggag
tacctgaacggacctctgcacacctggatccaggagaatgggggatgggaagccttcatggagctgtacggccgcaggcg
ggggtccagcgaagtgtggccgcacctcaaggccgtcgtcggactggtcgccctgggagttgtcggcgtccccatcgcag
cgtatatgatgctgaagtag
>gnl|bcl2dbcds|A0A3B3RKL3_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=894 residues).
atggatgttaccaatgtcaaattctttttagtgatcaactcctccataatgtccttgctgctctgttgcaaaatatggaa
tggctgtgtccgaattcaaggactgtattttgtaaaggacgtggtctacgaaggtgtagcctttattttattttttgttg
tatttctgacagtcgttgagaatccaaagcatagcaatgtttcttgttctctctttgcagtgaatatagccacttcattg
caggaggaaactcttatggtggcaaatgactacatggacttttgcattggaataaagaggacacctcccagcgagtccgc
taaagccatgcgatacctggcaaaggacgttgagagtatttatgggttcagactgcgcccacttgtgcagttgttcttgg
tcagcagtggctttgatacctggaccaaactcaggaatatgatgctggaggttattggaggtgaaatgatgagctgggga
cagattgtgtctctcttcgccttcatgggaatactggcagttcaactgtctactggggaagaagatgtcacctgcagtag
acggctagcggagatgatgacagatgttctcattggagaaaaacaagaatggatgatccaaaatggaggctggagggggt
tcgtggactatgtccacacagtcagacctggatatccagagtcacctgggaagacagctcttctcacagctgcaaatgtg
gcaattgcagggattgccagctccaaacgctcctcgtgcgtgtcacgccccctcattacctcctgtcggaatcctgattg
ttgtcacctgttccctattccgtttgccttgtctcttgtatttagtcctagtctcagtcagtcttgtcagattagacatt
gtgatgtcatgtaa
>gnl|bcl2dbcds|A0A3B3S872_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=576 residues).
atggccacctcattacatgacgaaactcttatggtggcaaatgattacatggacttatgtgttggaatcgagaggacacc
tcccagcgagtccgctaaagccatgcgatacatagcaaagaaggtggaggatatgtactggctcccactgcgccgtcttg
tgcagtcattcttgagcaactttcccatacacacctggaccgaactcaggaatgtgatgctggatatggttgatcgtgaa
aatatgaggtggtcccagattgtgattctcttcgccttcacgggaatgctggcagttcaaatgtctaccatagatgaaga
tttcacctgctgcagacggctagcagacatgatcactgatgttcttagagaaacacaggaatggatgatccagaatggag
gctggagggggttcgtggactatgtccgcatattcagaccagaatatccagtgtcacctgtgatgagaggtctcttcaca
gctgcaaatgtggcaattgcctttcttcttatcaattatctgctaaaaagatccctaccaggcttggtcccgttcaagaa
actgccagaaacatga
>gnl|bcl2dbcds|A0A3B3S872_uncBCL2A1-02 Putative BCL2-related protein A1 gene OS=[Eukaryota] Paramormyrops kingsleyae (length=684 residues).
atgggaatcatgaaatttgcgtgtgccgctggagtggtggctgccgccgctggtacagcgtacctctaccggcggttcag
gaaaacgccagagcaggaggaagtgaatatggccacctcattacatgacgaaactcttatggtggcaaatgattacatgg
acttatgtgttggaatcgagaggacacctcccagcgagtccgctaaagccatgcgatacatagcaaagaaggtggaggat
atgtactggctcccactgcgccgtcttgtgcagtcattcttgagcaactttcccatacacacctggaccgaactcaggaa
tgtgatgctggatatggttgatcgtgaaaatatgaggtggtcccagattgtgattctcttcgccttcacgggaatgctgg
cagttcaaatgtctaccatagatgaagatttcacctgctgcagacggctagcagacatgatcactgatgttcttagagaa
acacaggaatggatgatccagaatggaggctggagggggttcgtggactatgtccgcatattcagaccagaatatccagt
gtcacctgtgatgagaggtctcttcacagctgcaaatgtggcaattgcctttcttcttatcaattatctgctaaaaagat
ccctaccaggcttggtcccgttcaagaaactgccagaaacatga
© 1998-2019