Dataset for CDS BCL-2-like of organism Pan paniscus

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A2R8ZJX9_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=591 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacataaatctggctggatgacttttctagaagtt
acaggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaaccggcctaatttttctgactgttatgga
aacgattgccaacacatacttctacttttaa
>gnl|bcl2dbcds|A0A2R8ZJX9_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacataaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2R8ZJX9_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Pan paniscus GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatatttacaggctggctcaggactatctgcagtacgtcctacagataccacaacctgg
atcaggtccaagccaaacgtccagagtgctacaaaatgttgcattctcagtccaaaaagaagtggaaaagaatctgaagt
catgcttggacaatgttaatgttgtgtctgtagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgacagca
gattgccccggatgtggatacttataaggagatttcatattttgttgcggagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacaatcacacgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2R9A7B2_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Pan paniscus GN=BCL2L2 (length=507 residues).
atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaa
tgctggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatg
gtgcaacagcagaagagctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaattt
agtggccatcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtc
cctatttagaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttc
cacgagcccgctaccgcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccc
cggggtcgcgtctacaggtcaggatag
>gnl|bcl2dbcds|A0A2R9A7B2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Pan paniscus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2R9A7B2_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Pan paniscus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccaccaccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2R9APW6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Pan paniscus GN=BCL-2 (length=582 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccctcagcccggtgccacctgtggtccacctgaccctccgccagg
ccggcgacgacttctcccgccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcg
cggggacgctttgccacggtggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagtt
cggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagt
acctgaaccggcacctgcacacctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatg
cggcctctgtttgatttctcctggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctggg
tgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2R9BCD9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pan paniscus GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgtgagcgcactaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagatccaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2R9BYH6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
© 1998-2018