Dataset for CDS Unclassified of organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5P8E8_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ovis aries (length=417 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgggg
ctacgagtccccccccccccgcccccgcccgggggtctcctccccccgccccccccgccgcgacttcgccgagatgtcca
gccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaac
tgggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggt
ggacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggtag
gtgctcgtctgggtgtg
© 1998-2018