Dataset for CDS MCL-1 of organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5QI41_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ovis aries GN=MCL-1 (length=807 residues).
gggagccggaaaccccgccctgccccaggccccgcccctgccttgaccccgccggttaggtgccgtgcgcaaccgccgga
agctttcgctgccttccccatttacgggatgcagataaagaggcagcagcagtggttcaagatgtttggcttcaagaggc
gccctgccgtccggcctttacctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcctggagca
agcaaccggcaccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgcagag
tcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaagacgat
gtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttc
ttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacag
atgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccgtgtagag
gacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaat
aagatag
© 1998-2018