Dataset for CDS BCL-2-like of organism Ovis aries

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|Q9MZS7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|W5PSA5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagttttttcagaaaggatacagctggagtcagtt
tagtgacatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagtgccatcagtggca
acccatcctggcacctggcagatagccctgtggtgaatggagccactggtcacagcagaagcttggacaccgggaaaatg
atccccatggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggaaagcatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggggtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacctcaaccgctggt
ccctgacggacatgactgtggccggtatggctctgctgggcttgctcttcaactgtaag
>gnl|bcl2dbcds|W5Q0N6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ovis aries GN=BCL2A1 (length=528 residues).
atgactgacactgagtttgactacgttcacaagctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagacgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtctgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgagcaagcg
tattgcctcagacatggacatgtgcaaggacatttcttatttcgtggcggagttcatcaccaaaaacacaggagagtgga
taaggcaaaacggaggctgggaaaatggttttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgtctgaagcaatactattga
>gnl|bcl2dbcds|W5QDH5_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Ovis aries GN=BCL2L2 (length=669 residues).
atgggctggccaaacctgaaatacctccttctgggcctctcaccatatattcatgccagtcttttatgtttgactccaac
agccgcccggatggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggc
agaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
gatgagtttgagacccgcttccggcgcaccttctccgatttggcagctcagctgcatgtgaccccgggttcggcccagca
gcgcttcacccaggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
ccgcattgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctg
gagacgcggctggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctgga
ggaggcgcggcgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggccgtggcactttcgctagctg
agggctctggccgcttttttgcagaaagt
>gnl|bcl2dbcds|W5QDH5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ovis aries GN=BCL2L2 (length=1092 residues).
atgggctggccaaacctgaaatacctccttctgggcctctcaccatatattcatgccagtcttttatgtttgactccaac
agccgcccggatggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtgggctataagctgaggc
agaaggggtatgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctgga
gatgagtttgagacccgcttccggcgcaccttctccgatttggcagctcagctgcatgtgaccccgggttcggcccagca
gcgcttcacccaggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggag
ccgcattgtgtgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctg
gagacgcggctggctgactggatccacagcagtgggggctgggagctggaagcgatcaaagctcgagttagggagatgga
ggaagaagctgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccgggcaatgctg
gcccagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgca
acagcagaagagctagaagcacacttccatggctgtggttcagtcaaccgcgttactatactctgtgacaaatttagtgg
ccatcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgaatccttat
ttagaggaagacagatcaaggtgatccctaaacgaaccaacagaccaggcatcagcacaacagaccgaggtttcccacga
gcccgataccgtgcccgaaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
tcgcgtctacaggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|W5QI41_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ovis aries GN=MCL-1 (length=807 residues).
gggagccggaaaccccgccctgccccaggccccgcccctgccttgaccccgccggttaggtgccgtgcgcaaccgccgga
agctttcgctgccttccccatttacgggatgcagataaagaggcagcagcagtggttcaagatgtttggcttcaagaggc
gccctgccgtccggcctttacctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcctggagca
agcaaccggcaccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgcagag
tcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaagacgat
gtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttc
ttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacag
atgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccgtgtagag
gacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaat
aagatag
>gnl|bcl2dbcds|W5QIG4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ovis aries GN=BCL2L10 (length=582 residues).
ggtcggccccccggtagaggcggagccatggtggacccgtttagggagcgcacggcccggctgctgatggactggctgga
gttctgcgcccgggagcccggcactccagctcctgcgccgtccacgcccgaggctgctgtgctgcgccacgtggccgccc
gtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgctaccgcaggcaccgcgtcgagctggtggccaggatg
gcgcagaggctgctcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtctctgct
ggagaggcagccgcagacgacccgacggcagaagagagacgacggcagcgttagcagggactgtcggctcctcgtggccc
ttctctgcgctcagttctgcgaaaggcaccgcgcctggctgatggcgaacggcggctgggatggattttgtctctccttc
agccactcattgcaaccatcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatcta
cttctggataaaattatcgtga
© 1998-2018