Dataset for CDS BCL2L10 of organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5QIG4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ovis aries GN=BCL2L10 (length=582 residues).
ggtcggccccccggtagaggcggagccatggtggacccgtttagggagcgcacggcccggctgctgatggactggctgga
gttctgcgcccgggagcccggcactccagctcctgcgccgtccacgcccgaggctgctgtgctgcgccacgtggccgccc
gtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgctaccgcaggcaccgcgtcgagctggtggccaggatg
gcgcagaggctgctcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtctctgct
ggagaggcagccgcagacgacccgacggcagaagagagacgacggcagcgttagcagggactgtcggctcctcgtggccc
ttctctgcgctcagttctgcgaaaggcaccgcgcctggctgatggcgaacggcggctgggatggattttgtctctccttc
agccactcattgcaaccatcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatcta
cttctggataaaattatcgtga
© 1998-2018