Dataset for CDS BCL2A1 of organism Ovis aries

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5Q0N6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ovis aries GN=BCL2A1 (length=528 residues).
atgactgacactgagtttgactacgttcacaagctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagacgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtctgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgagcaagcg
tattgcctcagacatggacatgtgcaaggacatttcttatttcgtggcggagttcatcaccaaaaacacaggagagtgga
taaggcaaaacggaggctgggaaaatggttttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgtctgaagcaatactattga
© 1998-2018