Dataset for CDS BCL-2-like of organism Otolemur garnettii

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|H0WKI0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Otolemur garnettii GN=BCL-2 (length=717 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgctggagacgtgggcgttgcaccccccggggccgccactgcgccgggcgtcttctcctcccagcccg
ggcgcacccctactcccgctgcgccccgggacccggccgccaggacctcgcccccggccgcccccgccgccgccgccgcc
gcggagcctctgctcagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctctcgccgcta
ccgccgcgacttcgccgagatgtccagccagttgcacctgacgcccttcaccgcgagaggacgctttgccacggtggtgg
aggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagc
gtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctg
gatccaggataacggaggctgggacgcctttgtggaattgtatggccccagcatgcggcctctgtttgacttctcctggc
tgtctctgaagaccctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|H0WZ06_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L10 (length=576 residues).
atggcagacccgttgagggagcgcaccgagcggctgctgactgactacctggagtactgcgcgcgggatccgactgcccc
ggagccgacgccgtcctcgcccgaggccgccttgctgcgctccgtgaccgcctatatacagcagcgccactggtcctttt
tctccgcctacataggctaccccgggaatcgcgttcaggtggtggaacggatggtgaaggctatgctctcagacaaccag
agactcaactggggccgagtggtgacgctcgtgaccttcgcagggacgcttctacagaggcctccagtagaagccaggcg
ggagaagcaggacaagtcgcaactgaaggagggagaagacgaagtcgccagggattgccagcgcctagtggccctactga
gctctcggctggtggggcagcaccgcgtttggctggaggctcaaggcggctgggatggcttttgtcagttcttcaggaca
cccttaccgctagctttttggagaagattgctgttcgaagttttactgttgtgctttttagcaacggtcttcatctattt
ctggacacgacttact
>gnl|bcl2dbcds|H0WZ23_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2A1 (length=522 residues).
atgactgactgtgagtttggatacattcacaggctggctcaggactatctgcagtatgtcctgcaaatacagcaatgtgg
atcaggtccaagcaaaacgtccagagtgctgcaaaatgttgcattttcagtccaagaagaggttgaaaagagtctgaaac
catgcttagacaattttaatgttgtatccatagatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggcaggattgtgacaatatttgcctttggaggtattctcctcaagaaacttctccaacagcg
aattgccctggatgtggatacttataaggagatttcttattttgttgctgagttcataatgaattacacaggagaatgga
taaggcaaaatggaggctgggaacatggctttgtaaagaagtttgaacctaactctggctactctggctggctgactttt
ctggaagttacaagaaagatctgtgaaatgctgcctctcctg
>gnl|bcl2dbcds|H0X6V2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttatctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaggccccagaagggaatgaatcagagctggagacccccagtgccattaatggca
acccatcctggcacctggctgacagccccacggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatctcagctgcacatcaccccagggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgaattgtggcctttttctccttcggcggggctctgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacttgaatgaccacctagagccttggatccaggagaacggcgg
ctggtggaggtgtcaggcctttccagagcttctctctcccaaatcaaattccatttatttcaaagtttgcatgtgtggca
atttttgctctttggctgcagctgggagatgcttgactataggagttatgggttattct
>gnl|bcl2dbcds|H0XFB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggcgccgggctgggggctggcagcggcgg
cgccacacccccgggagggcggcttttggctgcggagaaggaggccgcggcccggcgagaggcagggggaggggaagccg
gcgaggtgattggcggaagccccggcgcgagttccccggcctccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggtgccgaagtccccgacgtcaccgcgacccccacgaggctgctgttcttcgcgcccaccctccgtgcggcgcc
gcgggaggagatggaagcccctgccgccgacgccatcatgtcgccggaagatgagctggacgggtacgagccggagcctt
tggggaagcggccggcggtcctgcctttgctggagttggtcggggaggccagtaacggccccagcactgatgggtcactt
ccttcgacaccgcccccagcagaggaggaggaggatgagttataccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggcgaccggtgccaaggacgcgaaaccaatgggcagggcaggagccgccagcaggaaggcgctggagaccttgc
gccgcgttggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|H0XHA5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=582 residues).
ctaccagaccagatggaagcccaagttgccgatgccgtcaagtcgcccgaaggtgaggtggcctcgtgcgagccggagcc
tctcaagaagcaaccggagggcctgcctttgctggagtttgttggtgaggccggtaacggccccagcactgacacacttc
cttccacacctcccccagcagaggaggaggatgagttatactggcagtcgatggagatcatctctcggtacctatgggag
caggaaactggagaggatatcaactctttgtctcgagtgatggcccatgttttcagttacggcgtaacaaattggggcag
gattatgaccctaatttttggtggctttgtggccaagcacctgaagaccataaaccaagaaggctacatcaaaccgctag
aagaaaatatcgcagatgtccttgtgaggacaaaaccggactggctagtcaaacaacgaggctgggatggctttgtggag
ttcttctacctggaagacctggaaagcagcgtcagaaacgtgctgctggctttcgcaggtgttgctggagtaggagctgg
cttgacctatctaataagatag
>gnl|bcl2dbcds|H0XR82_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggcccaggggagggcccagcaactgacccgttgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgtaccttctctgatctggcagctcagctacatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggccgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtagcctacctggagacacggc
tggctgactggatccatagcagtggtggctgggcggagttcacagctctatacggggacggggccctggaggaggctcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
© 1998-2018