Dataset for CDS BCL2L10 of organism Otolemur garnettii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0WZ06_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L10 (length=576 residues).
atggcagacccgttgagggagcgcaccgagcggctgctgactgactacctggagtactgcgcgcgggatccgactgcccc
ggagccgacgccgtcctcgcccgaggccgccttgctgcgctccgtgaccgcctatatacagcagcgccactggtcctttt
tctccgcctacataggctaccccgggaatcgcgttcaggtggtggaacggatggtgaaggctatgctctcagacaaccag
agactcaactggggccgagtggtgacgctcgtgaccttcgcagggacgcttctacagaggcctccagtagaagccaggcg
ggagaagcaggacaagtcgcaactgaaggagggagaagacgaagtcgccagggattgccagcgcctagtggccctactga
gctctcggctggtggggcagcaccgcgtttggctggaggctcaaggcggctgggatggcttttgtcagttcttcaggaca
cccttaccgctagctttttggagaagattgctgttcgaagttttactgttgtgctttttagcaacggtcttcatctattt
ctggacacgacttact
© 1998-2018