Dataset for CDS BCL2A1 of organism Otolemur garnettii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H0WZ23_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2A1 (length=522 residues).
atgactgactgtgagtttggatacattcacaggctggctcaggactatctgcagtatgtcctgcaaatacagcaatgtgg
atcaggtccaagcaaaacgtccagagtgctgcaaaatgttgcattttcagtccaagaagaggttgaaaagagtctgaaac
catgcttagacaattttaatgttgtatccatagatactgccagaacaatattcaatcaagtgatggaaaaggaatttgaa
gatggcatcattaactggggcaggattgtgacaatatttgcctttggaggtattctcctcaagaaacttctccaacagcg
aattgccctggatgtggatacttataaggagatttcttattttgttgctgagttcataatgaattacacaggagaatgga
taaggcaaaatggaggctgggaacatggctttgtaaagaagtttgaacctaactctggctactctggctggctgactttt
ctggaagttacaagaaagatctgtgaaatgctgcctctcctg
© 1998-2018