Dataset for CDS BCL2L1 of organism Osmerus mordax

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|C1BLI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Osmerus mordax GN=BCL2L1 (length=669 residues).
atgtcttacagtaaccgtgagctggtggtgttcttcataagctataaactttcacagaggaattatcctatttctcagtt
gggactggaagatgccagtgaacggactaatgttgacaagaccaatgtctccccagttaatggatctgttgaaaatgacc
gaaattgcataggcagtctggggatatcttcatctccacaggggggtatagaggcggttaaagcagctcttagagactct
gcagatgagtttgaattgcgttacaccagagccttcaatgatccctcttctcaactgcatatcacccctgctacagcata
ccatagctttgaaagtgtaatgaacgaggtgttcagggacggcgtcaactggggacgtgtagtaggcctgtttgcttttg
gtggtgctctttgtgctgagtgtgtcgagaaggatatgagtcacctggtagcgcgtattgcagattggatgaccacctac
ctggacaaccacatccagccatggatacagagacagggtggatgggaccgatttgctgacattttcggcagggatgctgc
tgctgaggttcgacgttcccaggagaacctaagaagatggctgctagtaggggcgatactgcttgcaggagtgttggtcg
gctctctcattgcaaagaaacatcattga
© 1998-2018