Dataset for CDS Unclassified of organism Oryzias melastigma

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3B3D197_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias melastigma (length=678 residues).
atggcgaacgtgtctcatcgcagtgttgtagaaacgtacatttgccacaaactctccaagaggggcttcgtgtgcggctt
ggacggcggccagcacgaggatgctgctaataacggctcgctcggtgaccgatccccgactccggtccgccgccgctgcg
acgcgggaacggggcctgacggcgagcgcagcccgcgcctcatccgcgcgcgggagccgcacgcggacatccacagagtt
ctgcgggaggctggagacgagctggagcggctgtaccagcgggacttcacggagatgtcgcggcagctgtacctcacctc
caccacggcgaagacccgcttcgccgaggtgattgacgaactgttccgggacggggtgaactggggccggattatcgcgt
tcttcgagttcgggggcacggtgtgcgtggagtgcgcgtccgacgaggagatgagcgcgcaggtggccagcatcgccgag
tggatgacggaatatttaaacggacctctcaacagctggatagaagataacgggggatgggatgcgttcgtggagctgta
cgacagacagaaggaaaccgtcttcagctgctactggccgtccatcaagactgtcttcggcctggctgctctcggggcag
cgagcctgaccatcggagcataccttgcacaaaagtga
© 1998-2019