Dataset for CDS MCL-1 of organism Oryzias melastigma

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3B3CEX1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias melastigma GN=MCL-1 (length=813 residues).
atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctgtggatgtacggcactcttcggcggagcggg
agagagatccgcgcgcgtgcctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaacagatgaaaa
gaccgcaggacctcgacatgttagggaataaatctccgtatgcggcgaggaggtttcacgacgacgacggcggctctctc
ccgaacaccccggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgataaaccaggacaccacggaatt
cctcacgaacttctttaggaactatgttggattatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatgatcaataggctgtctttggaagacaatttg
gacgatatgtcatttattagccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgcatcgccagcct
gctggccttcggggcggcggtgtgtctgcagctgaaggagaagggcagaggtcactccgtggacctggtcagtcaggaga
tctgcacgtacctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatggtttcgtagagttctttcac
gtcccagacccagaatcaacagtcaggaacactttggtggccgtccttggacttgcaggcgttggggctttactggccca
ggtgtgtaggtga
>gnl|bcl2dbcds|A0A3B3CEX1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias melastigma GN=MCL-1 (length=906 residues).
atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctgtggatgtacggcactcttcggcggagcggg
agagagatccgcgcgcgtgcctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaacagatgaaaa
gaccgcaggacctcgacatgttagggaataaatctccgtatgcggcgaggaggtttcacgacgacgacggcggctctctc
ccgaacaccccggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgataaaccaggacaccacggaatt
cctcacgaacttctttaggaactatgttggattatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatgatcaataggctgtctttggaagacaatttg
gacgatatgtcatttattagccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgcatcgccagcct
gctggccttcggggcggcggtgtgtctgcagctgaaggagaagggcagaggtcactccgtggacctggtcagtcaggaga
tctgcacgtacctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatggtttcgtagagttctttcac
gtcccagacccagaatcaacagtcaggaacactttggtggccgtccttggacttgcaggcgttggggctttactggccca
ggtgcaaggtccataccgtatttggcaggatatgacatcatgtcacactaatctatccaaaaataaagttggaagatcac
caagttttgctgttgaagggccgtaa
© 1998-2019