Dataset for CDS Unclassified of organism Oryzias latipes

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|H2MQI3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias latipes (length=597 residues).
atggcgaacgtgtctaatcgcagtattgtagaaaagtacatctgccacaaactctccaagaggggctacgtgtgtgggct
gaacggcggccagcgcgagaatgctgccaataacggctcggttggggaccattccccgactccggtccgccgccgctgcg
acgcaggaacggggcctgacgaggagagcagcccccgcctcatcagagcgctctcccgggcggacccgctcgcggacatc
cacagggtcctgcgcgaggcgggagacgagctggagcggctgtaccagcgggacttcacggagatgtcgcggcagctgta
cctcacctccaccacggcgaagacgaggttcgccgaggtgattgacgaactgttccgggacggcgtgaactggggccgga
ttatcgcgttcttcgagttcgggggcacggtgtgcgtggagtgcgcgtccaacgaggagatgagcacgcaggtggccagc
atcgccgagtggatgacggagtatttaaacggacctctcaacagctggattgaagaaaacgggggatggtcatctgttga
gcatgcaggctcgaattctgcgtctgattttgcagac
>gnl|bcl2dbcds|H2MQI3_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oryzias latipes (length=609 residues).
atggcgaacgtgtctaatcgcagtattgtagaaaagtacatctgccacaaactctccaagaggggctacgtgtgtgggct
gaacggcggccagcgcgagaatgctgccaataacggctcggttggggaccattccccgactccggcggacccgctcgcgg
acatccacagggtcctgcgcgaggcgggagacgagctggagcggctgtaccagcgggacttcacggagatgtcgcggcag
ctgtacctcacctccaccacggcgaagacgaggttcgccgaggtgattgacgaactgttccgggacggcgtgaactgggg
ccggattatcgcgttcttcgagttcgggggcacggtgtgcgtggagtgcgcgtccaacgaggagatgagcacgcaggtgg
ccagcatcgccgagtggatgacggagtatttaaacggacctctcaacagctggattgaagaaaacgggggatggatgtgc
agattaggattatttggcaaaaaaagagcagtttataggtttgaatatccaaaaacttcatcacggtggtgctgtgccat
tcatagtttaattgctggctctaaattgcccttagagttggcagctcgt
© 1998-2018