Dataset for CDS MCL-1 of organism Oryzias latipes

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|H2MLZ3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=807 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttag
taggtga
>gnl|bcl2dbcds|H2MLZ3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=858 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaa
tatgatggccatttttaaaggacttcctgcttctaccagacttcacaactcgagatag
© 1998-2018