Dataset for CDS BCL-2-like of organism Oryzias latipes

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A3B3IB64_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgcccttgccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgcggctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B3ICL7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtcagcagtgaggacggccggctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgagt
gtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3B3ICL7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggtccggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtcagcagtgaggacg
gccggctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgt
gtgtcgagtgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|H2MBQ3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagaatggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|H2MLZ3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=807 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttag
taggtga
>gnl|bcl2dbcds|H2MLZ3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=858 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaa
tatgatggccatttttaaaggacttcctgcttctaccagacttcacaactcgagatag
© 1998-2019