Dataset for CDS BCL2L1 of organism Oryzias latipes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|H2MFY6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=666 residues).
caagctcacacaatgtcccactgtaacagagagctggtccggttctatttagcctataagatgtcatgcagggactatcc
tgtgtccctgctgaagcccacagacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtca
gcagtgaggacggccggctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcg
gccgatgagtttgaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggccta
ccaaaacttcaaaagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttg
gtggtgcgctgtgtgtcgagtgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtac
ctggatgagcaaataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgc
tgcagaagcgaggagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgg
gtgtgctcatcaccaagaaacggtga
© 1998-2018