Dataset for CDS BCL-2-like of organism Ornithorhynchus anatinus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F6S8G3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2A1 (length=528 residues).
atggacgacggtgtattctggtccgtccgagccctggctctggactatctggatgacgtcctccagacgccgcgacttgg
gacggtcccaagcagaacttctcgggcgctgcaaaacgtcatgttctcggtccagggggacgtggagaaggctctgaagc
cgtgcttcgacagtctcgacgttggctcggtaggggcagccagaagaatcttcggccaaattgtggaaaaggagttcgag
gacggcatcgtcaactgggggcggattgtgacgatatttgtcttggggggcattctcaccaagaagctccaaaggagcgg
agtcccgctgacgagagagactcgggaggagatttcttgtttcatcgcggagttcaccacccaccacgccggagagtgga
taaggcagaacggaggctgggaaaatggatttttaaataagtttgaacaaaagaccgtctggtcggtgttagcggatatt
tcgatgaagatcttgggcgtactctcccacctgaagcaattttactga
>gnl|bcl2dbcds|F7G6M3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L2 (length=735 residues).
atgccaagtgcccggaattctcccctcccccgccagtcggccgcccctcagccctgctgtcttgccccctgcccctccag
gccccccggcagccctcctgacgcccctccacggcctccccctccccgctgtcctgcagccccccggatggcgaccccgg
ccccggcctcggtctcagacacccgggccctggtggcggactttgtgggctacaagctgcggcagaagggcttcgcctgc
ggggccgggcccggggagggccccccggcccagcccctgcaccgggccatgcgggccgccggggacgagttcgagtcacg
cttccggcgggccttctcggacttggcgtcccagctgcacgtgacgcccggctcggcccagcagcgcttcacccaggtgt
cggacgagctcttccagggggggcccaactggggccggctggtggccttcttcgtgttcggggccgcgctctgcgccgag
agcgtcaacaaggagatggagcccctggtggggcaggtgcaggactggatggtggcctacctggacacccagctggccga
ctggatccgcagcagcgggggctgggcggagttcacggccctgtacggggacggggccctggaggacgcccggcgcctgc
gggagggcaactgggcctccgtccggaccgtgctgacgggggccgtggcgctgggagccctggtgaccgtcggggccttc
ttcgcgagcaaatga
© 1998-2018