Dataset for CDS BCL2L2 of organism Ornithorhynchus anatinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7G6M3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L2 (length=735 residues).
atgccaagtgcccggaattctcccctcccccgccagtcggccgcccctcagccctgctgtcttgccccctgcccctccag
gccccccggcagccctcctgacgcccctccacggcctccccctccccgctgtcctgcagccccccggatggcgaccccgg
ccccggcctcggtctcagacacccgggccctggtggcggactttgtgggctacaagctgcggcagaagggcttcgcctgc
ggggccgggcccggggagggccccccggcccagcccctgcaccgggccatgcgggccgccggggacgagttcgagtcacg
cttccggcgggccttctcggacttggcgtcccagctgcacgtgacgcccggctcggcccagcagcgcttcacccaggtgt
cggacgagctcttccagggggggcccaactggggccggctggtggccttcttcgtgttcggggccgcgctctgcgccgag
agcgtcaacaaggagatggagcccctggtggggcaggtgcaggactggatggtggcctacctggacacccagctggccga
ctggatccgcagcagcgggggctgggcggagttcacggccctgtacggggacggggccctggaggacgcccggcgcctgc
gggagggcaactgggcctccgtccggaccgtgctgacgggggccgtggcgctgggagccctggtgaccgtcggggccttc
ttcgcgagcaaatga
© 1998-2018