Dataset for CDS Unclassified of organism Oreochromis niloticus

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|I3JTS4_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=675 residues).
gccggaatggcgaacgagtataatcgcaatattgtggaaaagtatatctgccataaactctccaagcggggatacgtgtg
gggatttcgcgttgtccaagaagaagatgctgctaataacggatcgataactgaccctccaccgactttggtccaccggt
gccgagaagccagcaccgggcctgacggcgagagcaacacccacctctgcagacggctcccacagtccgacccacacgca
ggcatccacagagtcctgcgcgaggctggagatgaacttgaaagactgtaccagccggacttcacggagatgtcgcggca
gctgcatctcacctccgccacggcgcagaggaggttcgccgaggtgatagacgaactgttccgggacggagtgaactggg
gccggattattgctttcttcgagtttgggggcacggtgtgcgtggagtgcgcttccaacgaggggatgtcatcccaggtg
gacaacatcgcagactggatgacggagtatttaaatggacctcttaacagctggatacaagataacgggggatggagtgc
taatctgcagccactgtgtttaacatgccgtcctctgtttgcatcttggttgggactcttttgtctgcctttttcagacc
tgtgccttgaagctggcgcagactggggccgcaga
>gnl|bcl2dbcds|I3KLB2_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=441 residues).
cagggggcgatggctgccgcctacaacagccgggacctggtggaggacttcctgcgctacaagctgctcggcaggggcgt
ggcttggcctcagcacccccccgtggccccgccccgcctgcaggctgtgctgcggagcgccagcgatgagttggagcgac
ttcacggcaacgagctatctgcgcaggtgacagtgctgcgactgcgtgggaacggcggcggtgctgcacgtcggcgccac
ctgacggctatcagagaggagctgttcagggacggcgtgaactggggacgcatcgtcaccatgatggagctgggcggagc
tctgagtgccgcagccgccaagtcgggcgacgaaggtcaggtggatgatatcgccagctggatggaggagagtctggact
ctccgtcgctccgaagatggatccatgacaacggaggatgg
>gnl|bcl2dbcds|I3KLB2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oreochromis niloticus (length=507 residues).
cccccctcccctctggcaaacactacaggtccatcagacccccccgtggccccgccccgcctgcaggctgtgctgcggag
cgccagcgatgagttggagcgacttcacggcaacgagctatctgcgcaggtgacagtgctgcgactgcgtgggaacggcg
gcggtgctgcacgtcggcgccacctgacggctatcagagaggagctgttcagggacggcgtgaactggggacgcatcgtc
accatgatggagctgggcggagctctgagtgccgcagccgccaagtcgggcgacgaaggtcaggtggatgatatcgccag
ctggatggaggagagtctggactctccgtcgctccgaagatggatccatgacaacggaggatgggatgcttttgtggagc
tgtatgagtccagacccacagacagcttctggtccctgaggacagtgttaggactggtcgtactgggagcagttggggtt
atactgggatttctattcagccagaaa
>gnl|bcl2dbcds|I3KWT0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus (length=597 residues).
gagatgcagtgcagtaaccgagagctggtggagttctttataagctataaactgtctcagaagaatcacccaacttccct
tctgaggccaaccaatgggggccaaaggactgagagagacctggcccaatctctgcctgcatacaatggcatagaggctt
taaaatcagctcttctagactcaggggagcagtttggttttctgttcacacagtcttttagggacgttgcttcgcacctc
agcatcacgccggacacagcccagcaatgcttcgagagcgtgatggaggagttgttcagggatggaatcaactgggggcg
tataattggtctgtttgtctttggttctgcaatgtgtctggactgtattgacagcaatatgagtgagctggtacccgaca
ttgcagactggatgactgcgtatctagatgatcacattagtctgtggatccaacgaaatggaggatgggaccgctttaca
gagatatttgggaaagggatgtctacaaggagctctggggagtctctgaagagatggctatttgttggagtggccttagt
aacagggctgctggttggcatgctcatgacagattaa
© 1998-2018