Dataset for CDS MCL-1 of organism Oreochromis niloticus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|I3JHR5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=837 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|I3KXG5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=507 residues).
ctggagagagaaactaaactcattattcacagttttttgggagactttactggactttctcagcctcaacgaaaggaaac
caaagcactaaaaatgatgaaaagagttgttgcggacgtattagaaaagcacagatatgcttacaacggaatgattaata
aattgtcattggatgaaagagaagaagatatgtcatttgtagcgaagagcctctttggagaccacacgaccaactggggt
cgtattgtcagctttgtggccttcggggcagtggtgtctcagcacctgaaggaaaagggcagggacaactgcgtggtgct
agtgagtcaagagatttctgcatacttgctgtctgaacagcgagactggattatcaaaaacaatgcatgggatggctttg
tggcgttcgttcgagtagcagaccctgagtcgatagtcaggaacacactcatggcctttgctggatttgcttgtattggg
gcaacactggcactgttgatcaggtga
© 1998-2018