Dataset for CDS BCL2L1 of organism Oncorhynchus mykiss

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A286MU87_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgacggagatgaggccattgcaaatgggtctgtggggaactaccggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctacgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggatgaccacctatctggacaac
catatccagccctggatccagagccaaggcggatgggcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
© 1998-2018