Dataset for CDS Unclassified of organism Octopus bimaculoides

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A0L8G405_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Octopus bimaculoides (length=639 residues).
atgggttcttcgtcaaataacaactccgagatgaatgtgccggtctctcggtatttgcttgaagattatgttaactaccg
tctaagaaggcagggttttacctgggaaaactgtccctgctttgaccgccgtccaagtaaagtggcaatcagtatgcgtg
ccatggccgatgagtttgaggaaagatatcatgaccaattctcaaatatgtgccaacaacttcatattactcagcataca
gcttactgcacttttcaggctgttattaatgaactttttagtgaccagactattaactggggtcgaattgtcgccctatt
ctctttcagtggagctttatcccttcagagtgttgagaaagaaatgccttatcttgtggacaacattgtagaatgggctc
atacgtacttaactgataacttgaacacttggataaatgcacatggtggatgggaagacaaagacaaaattgagagtttg
gataagttaaagattctttgtttggttcatgcaggcagttatttcatgttgaaccatccaacccagatcagattggagcc
tggtgcagccgctggctctccaggccttagtcaaaccgtccaacccatgccagcatggaaagcggttgttaaacgatga
>gnl|bcl2dbcds|A0A0L8HGC1_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Octopus bimaculoides (length=621 residues).
atggtctctgtcctgacgaatatcttttgtagtattaactcctcgcctgttatgcacccccttcaatccgtgattcgcat
ggataaggaagaaaatttgaaatcttgtagaaaagaggtgcctagaatggtcaaagacatggtgttgaacttcgataaag
gtcatttcatttcgcaacccgaatccgacatttgtgcaggcatgaggaaatcagtattagaaatttacaacatttataga
gatgcgttgtataaaaatgttgcccaattgttagacgaagttgcagatgacttaacaatccaaaaggcgtaccgttgcgt
agtggagaccatcctggaggatcgtaaaaatttacattggcgtcgtatctctatggttttcacgatgttggctgttttgg
ccgaagatcaacgatccaaacatcatgacctttcatgggaacagtataaccagatcttgataaaactctttaaagaacac
aagatcgacacctggataaatgataacagcggatgggatggcttcctggaacatattcagatgaaacacaagaataaatt
ggaagaatttatctggttgagtacaattggactctggtctttgtcagtttctggtttgtga
© 1998-2018