Dataset for CDS BCL-2-like of organism Nomascus leucogenys

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A2I3GB35_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=816 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=1053 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=444 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
catgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3GZF9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccattataagctgtcgcagagggg
ctacgagtgggatgcgggagatgtgggcgccgcgcccccgggggccgcccccgcaccgggcatcttctcctcccagccgg
ggcacacgccccatccagctgcatcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccggcgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgatgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggatgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A2I3HNF3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=528 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgtgaaatgctctctttcctgaagcaatactgttga
>gnl|bcl2dbcds|A0A2I3HNF3_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=618 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctcaatactgttgactagaaaggacactccatattgtgaaaccggcctaatttttctgactcttatgga
aacaattgccaacacatacttctactttaaaataaacaactttgatgatgtaacttga
>gnl|bcl2dbcds|A0A2I3HNF3_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2A1 (length=492 residues).
atgacagactgcgaatttggatatatttacaggctagctcaggactatctgcagtacgtcctacagataccacagcctgg
atcaggtccaagcaaaacgtccagagtgctacaaaacgttgcgttctcagtccaaaaagaagtggaaaagaatctgaagc
cgtgcttggacaatgttaatgttgtgtccatagacactgccagaacactattcaaccaagtgatggaaaaggagtttgaa
gatggcatcattaactggggaagaattgtaaccatatttgcatttgaaggtattctcgtcaagaaacttctacgacagcg
aactgccccggatgtggatacttacaaggagatttcgtattttgttgcagagttcataatgaataacacaggagaatgga
taaggcaaaacggaggctgggggaaatggcataatcacatgcctatgctggtagagtcagtggcccacaagaagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|G1R3W6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L10 (length=696 residues).
atggttgaccagttgcgggagcgcaccgagcggctgctggccgactacctggggtgctgcgcccgggaacccggcacccc
cgagccgacgccgtccacgcccgaggccgccatgctgcgctccgcggccgccaggttacggcagctccacccgtccttct
tctccgcctacctcggctaccctgggaaccgcgtcgagctggtggtgctgatggcggattccgtgctctccgacagcccc
ggccccacctggggcagagtggtgacgctcgtggccttcgcagggacgctgctggagagagggccgctggtgaccgcccg
gtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcgcctcgtggggcagcaccgcgcctggctgcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacacggggcgggacgggcagccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggaccccct
ttccgctggctttttggagaaaacagctggtccaggcttttctgtcatgcttgttaacaacagccttcatttatttctgg
acacgattattatgagttttaaaacttttaacccgcttctacctgcacagctgtga
>gnl|bcl2dbcds|G1RER8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L1 (length=651 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggc
>gnl|bcl2dbcds|G1RYB4_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|G1RYB4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
© 1998-2018