Dataset for CDS BCL2L2 of organism Nomascus leucogenys

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G1RYB4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
tggctgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctgtttagaggaag
gcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggttttccacgagcccgctacc
gcgcccggaccaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|G1RYB4_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaactttttcaagggggccccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacttggagacgcggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
© 1998-2018