Dataset for CDS BCL2L1 of organism Neolamprologus brichardi

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q4N4B5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neolamprologus brichardi GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggctttttgcgttcggtggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcacttcgctgaaatctttgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgtcgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
© 1998-2019