Dataset for CDS Unclassified of organism Nematostella vectensis

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A7S109_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Nematostella vectensis (length=429 residues).
atggtgaaggatttcatcggctacaaactacggcaaaataacatattcctggagggatttaatatggaatctccgaccaa
agcctcgaagcatttaagaattgtggctgatgaattaattgcggacaacagcgagctatttcattctatgtgtgaccaac
tgcatctcactccaatttcaacttatccaacttttgttggaatcgccaatgagatcttccaatcgggcaaaaactggggt
agagttgttgcttttcttgcttttggagcaacccttgcagtttattgcgcccaaagagaggaattacacgaattagtgaa
cgacattgtagaatgggtctcacgctacatggaccaaaacctgtcctgctggattcgagaaaatggtggctgggtaagat
ttcaacaagtatttctcgctttaaaataa
>gnl|bcl2dbcds|A7S9S4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Nematostella vectensis (length=492 residues).
atggctgctttacaggcgcagagaaaaccgtgttcggagacgttagagacgttgaaccgacaagctcacttcttggctca
agacctgatatcataccgtacaggcaatggaagaatctccacaagtctgacagcgcgcaatatgaggagacttagcgacg
agctcgaggaaaggcacgggccgctgctttgtaacatgtgcaatagtctaaacatgactgcaaattcggcgcacgagaaa
ttcgtgcaagttgctgatgaggtgttcaaggatggtataaactgggggagaatcgtcgctgtttttacgtttgggggtag
acttgcgcagttctgcgcgagaaacggtttgcacgatggcgtacgagaagtcgaggcttggttaggggactacatcgcga
atctgtcccactggatacagacccaagggggatgggtttgcacgtttgaaacgagccagtcgcacgattctgcaaacttt
gcacgtttttga
>gnl|bcl2dbcds|A7SFS9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Nematostella vectensis (length=543 residues).
atggaataccctcgaaacgacccaagacagagctatccagagcttgttcaccaagcacagcttctggccaaggatcttat
ttcgtatcgactcgggaaaaatccgaaaccacccaacgcaaatgcagaaactctacgcaaactggcggacaaaatcgaag
aacagtatcccgcacttttaaatcacttgtgtcataaattgaatatctctagaagcactgcgtacagcacatttgtagaa
atagcaggggaagtttttgctgacggggtaaattggggaaggatcgttgttttgtatgcgtttggtggtcggttggctgt
atattgcgaacaacataacatgaaagatcttgttcaatcagtaacagattgggtcggaaaatacatcgccgggctaagcg
aatggatcgccaacgaaggaggatgggatgggcttaaggagcaattcagggacaataatacaaatgatacaacttggtgg
aagggcgtcttcatcactacacttggaattgggacattagcagcactggtatacacaagatga
>gnl|bcl2dbcds|A7SPR2_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Nematostella vectensis (length=567 residues).
atgcctccaattgaaggatacgacaatgcaaacgctgttgctgcaagaaaaatgaaaactcccgaggagaaaatcgcaca
cgaactagcgaaggactttatcggttacaaactcgggaaaggaactcgactcaatacgaaatctgcgcttattctgagaa
agctcagtaaccagatcgaaaataagcatgaactattcttaaggaacatgtgtgatcgcttggacattcgacaacacaat
gctcccgagacatttaagcaagtagccgacgagatctttggcgatgggataaattggggacggatagttgttctttacac
cttcgccggaaaggttgcgaaatactgtcaggaaaatcagctagacaacgctgaaaacgtagcgacttgggttgggaatt
atgttgcctctaaatctgactgggtcaagaaagctggaggatgggaggcttttaatgagcaatttaaggatgtccaagag
gaacatgaaaagttctggtggaatagtttgctgtgcacaacactaggcctgggatctctagccgctgtcctctacatgaa
gagctaa
© 1998-2018