Dataset for CDS MCL-1 of organism Myotis lucifugus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G1PZ39_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=795 residues).
gccccgccctctcccattagcggccgagggccccgacgtcatcgggacccttcgcgcggcggctgtttgcgccccttggc
tgtgcggggctgcccgcggagatggaaagccgcggccgccgacgccatcatgtcgccggaagaggagctggacgggtacg
agccggagcctctcgggaagcggccggccgtcctgcccttggtgcagctggtcggggaggccagcggcggccccggcgcg
gggggctcgctgccctccacgccgccccccgcggaggaggaggaggacgagctgttccggcagtcgctggagatcatctc
tcggtaccgggagcaggcgaccggcgccaaggacgccaagcccctgggcgggcccgcggcctccagccggaaggcgctgg
agaccctgcggcgggtcggggacggcgtgcagcggaaccacgagatggccttccaaggtgagcgggggccgcgcgccctc
tgtcttgtccgcgatcgctgggctcccgtgggtggaaaccgagacgagcccgggctggaagggctctccgcccgtttccg
aaaccagcatattctggccatgagtcattgtttccgcccacccgattccttgggaaccgctctccgctcaaaggccggaa
aggtgtgggagacctccaacacttgccatggcttcaaggatgggtttgtggaattcttccatgtagaggacctagaaggc
ggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1QAV8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=975 residues).
atgtttggccccaaaagaaatgcattcatcggactcaacctccactgcgggggggcagttgggggcctgtggcggcagcg
aagcctacatctccttcaggaaggaggtccctgcccccaagagtcaggggcggggagggaaacgggcacggtgattggct
ggagcgctggcgcgagcccccaagccactctcgcgagggatcctgggagggtcgctcgcccctcgcccatgggcacggag
ggtcccgatggcaccgcggcccctgccaggtggctgttctcgcccatcagccggaattgccctgaagagctgggagctct
ggcagccgacgccatcatgtcgcccggagaggagctgggcaggtatgagccggagccgaagcagccggctgtcctgccct
tgctccagctggtcggggaggccagcgaaggccccgcaggtggctcactgccctcgaccccgccccctgctgaggaggag
gaggaattgtcactgctggagatgatccctcagcaccttagggaacgggctggcgccagggaccaaagccagggcccgcg
ggtcggcggggtgcagcggcgtgcagcagggtgcagcggggtgcggcaggagactgccttcctaggtatgcttgaactgg
acaccgaaaacgaagacaacgtcaaatcttcgtctcaagcgatggttcatgcttttagggacggagtgacaaacggcagg
attgtgactcatttcttttggtgcctttgtagccacttgaagagcataaaccaagaaagctgcattgaaccgttagcaga
agacatcacagatgttctcgtagggacagaacgaggctggctagtcaaacagagaggctgggatgggtttgtggaattct
tccaggtggaggacctagaaggcggcgtcagaaatgtgctgctggcttttgcaggtgctggagtaggagctggtttgcca
tatctaataaggtag
© 1998-2018