Dataset for CDS BCL-2-like of organism Myotis lucifugus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|G1P3J2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L2 (length=660 residues).
cctgaaatgctccattctgtgtctctgactaaatatactcatgccagtcttttatccttgacctttacagccgcccggat
ggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggctacaagctgaggcagaagggttatg
tttgtggagcgggtcccggagagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgag
acccgtttccgtcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcaccca
ggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggagctgctctgtgtg
ctgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtggatggtggcctacctggagacgcggctg
gccgactggatccacagtagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggctcgacg
cctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactaggggccttggtaactgtaggag
cattttttgctagcaagtga
>gnl|bcl2dbcds|G1P9D2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggaactggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccctgcggtgaatggagccactggccacagcagtagcttggatgcccgggaggtg
attcccatggcagcggtgaagcaagcgctgagggaggcaggcgacgagtttgaactgaggtaccggcgggcgttcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaagtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctcgttcggtggggcattgtgcgtggaaagtgtggacaaggagatgcag
gtattggtgagtcggattgcaacgtggatggccacttacctgaatgaccacctagagccttggatccaggagaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggaacgcttcaatcgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1PZ39_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=795 residues).
gccccgccctctcccattagcggccgagggccccgacgtcatcgggacccttcgcgcggcggctgtttgcgccccttggc
tgtgcggggctgcccgcggagatggaaagccgcggccgccgacgccatcatgtcgccggaagaggagctggacgggtacg
agccggagcctctcgggaagcggccggccgtcctgcccttggtgcagctggtcggggaggccagcggcggccccggcgcg
gggggctcgctgccctccacgccgccccccgcggaggaggaggaggacgagctgttccggcagtcgctggagatcatctc
tcggtaccgggagcaggcgaccggcgccaaggacgccaagcccctgggcgggcccgcggcctccagccggaaggcgctgg
agaccctgcggcgggtcggggacggcgtgcagcggaaccacgagatggccttccaaggtgagcgggggccgcgcgccctc
tgtcttgtccgcgatcgctgggctcccgtgggtggaaaccgagacgagcccgggctggaagggctctccgcccgtttccg
aaaccagcatattctggccatgagtcattgtttccgcccacccgattccttgggaaccgctctccgctcaaaggccggaa
aggtgtgggagacctccaacacttgccatggcttcaaggatgggtttgtggaattcttccatgtagaggacctagaaggc
ggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1Q051_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L2 (length=621 residues).
atgaatgaattttctctagacaactttatgctctatagttttgattctgttgatattaggcccaaagtgctgggtcctaa
gagctcccagcctcaggccccagacacacaggctctggtggcagactttgtaggctacaagctgaggcagaagggttatg
tttgtggagcgggtcccggagagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttgag
acccatttccgatgcaccttctctgatctggtggctcagctgcatgtgaccccaggttcagcccagcaatgtttcaccca
ggtctctgatgaactcttccaggggggccccaactggggttaccttgtggccttctttgtctttggagctgctctgtgtg
ttgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtggacggtggcctacctggagatgcggctg
gctgactggatccacagtattgggggctgggcagagttcacagctctatacgggaactgggcctcagtgaggacagtgct
gacgggggccctggcactaagggccttgttaactgtaggagcattttttgctagcatgtga
>gnl|bcl2dbcds|G1QAV8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=975 residues).
atgtttggccccaaaagaaatgcattcatcggactcaacctccactgcgggggggcagttgggggcctgtggcggcagcg
aagcctacatctccttcaggaaggaggtccctgcccccaagagtcaggggcggggagggaaacgggcacggtgattggct
ggagcgctggcgcgagcccccaagccactctcgcgagggatcctgggagggtcgctcgcccctcgcccatgggcacggag
ggtcccgatggcaccgcggcccctgccaggtggctgttctcgcccatcagccggaattgccctgaagagctgggagctct
ggcagccgacgccatcatgtcgcccggagaggagctgggcaggtatgagccggagccgaagcagccggctgtcctgccct
tgctccagctggtcggggaggccagcgaaggccccgcaggtggctcactgccctcgaccccgccccctgctgaggaggag
gaggaattgtcactgctggagatgatccctcagcaccttagggaacgggctggcgccagggaccaaagccagggcccgcg
ggtcggcggggtgcagcggcgtgcagcagggtgcagcggggtgcggcaggagactgccttcctaggtatgcttgaactgg
acaccgaaaacgaagacaacgtcaaatcttcgtctcaagcgatggttcatgcttttagggacggagtgacaaacggcagg
attgtgactcatttcttttggtgcctttgtagccacttgaagagcataaaccaagaaagctgcattgaaccgttagcaga
agacatcacagatgttctcgtagggacagaacgaggctggctagtcaaacagagaggctgggatgggtttgtggaattct
tccaggtggaggacctagaaggcggcgtcagaaatgtgctgctggcttttgcaggtgctggagtaggagctggtttgcca
tatctaataaggtag
>gnl|bcl2dbcds|G1QEX2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L10 (length=537 residues).
gacgagttgaagttgcgcacccgacggctgctgaccgagttcctggaacaccgcacccgaaggcgcggcactgccccgca
gcagccgtccacgcccgaggccaccgtgatgcgctccctggctgctcattcgtggctgggtaccccgcactcctggtccc
ggaggcagagaaaccgactcgagcagatggtcgaccagatagagtcgctagttccagacggcacagaccccaactggttg
agcgtggtggcgctcgtgtccttcgcgggggccctgctggagagaccgccgccaggccactcgcaggcacgcagggaatg
ggatgccaccgttgaccaggactgccagcgcctggtcaccttcctgtgcagttggctcacggagacgcaccgcacctgga
tggaggcgcaaggtggctgggatggcttttgtcacaacttcatgcctgcaccgccgcctggggacagactgctggctccg
cttctgagggcatgccttgtactcataatcttaatctgcttgtggataaaaatcatg
© 1998-2018