Dataset for CDS BCL2L2 of organism Myotis lucifugus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G1P3J2_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L2 (length=660 residues).
cctgaaatgctccattctgtgtctctgactaaatatactcatgccagtcttttatccttgacctttacagccgcccggat
ggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggctacaagctgaggcagaagggttatg
tttgtggagcgggtcccggagagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcgag
acccgtttccgtcgcaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcaacgcttcaccca
ggtctctgatgaactcttccaagggggccccaactggggtcgccttgtggccttctttgtctttggagctgctctgtgtg
ctgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtggatggtggcctacctggagacgcggctg
gccgactggatccacagtagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggctcgacg
cctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactaggggccttggtaactgtaggag
cattttttgctagcaagtga
>gnl|bcl2dbcds|G1Q051_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L2 (length=621 residues).
atgaatgaattttctctagacaactttatgctctatagttttgattctgttgatattaggcccaaagtgctgggtcctaa
gagctcccagcctcaggccccagacacacaggctctggtggcagactttgtaggctacaagctgaggcagaagggttatg
tttgtggagcgggtcccggagagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttgag
acccatttccgatgcaccttctctgatctggtggctcagctgcatgtgaccccaggttcagcccagcaatgtttcaccca
ggtctctgatgaactcttccaggggggccccaactggggttaccttgtggccttctttgtctttggagctgctctgtgtg
ttgagagtgtcaacaaggagatggagccacttgtgggacaagtacaggagtggacggtggcctacctggagatgcggctg
gctgactggatccacagtattgggggctgggcagagttcacagctctatacgggaactgggcctcagtgaggacagtgct
gacgggggccctggcactaagggccttgttaactgtaggagcattttttgctagcatgtga
© 1998-2018