Dataset for CDS Unclassified of organism Myotis gammaherpesvirus 8

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A109QG17_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Viruses] Myotis gammaherpesvirus 8 (length=534 residues).
atggcacatgctggaagaactgaatatgacaacagagaaatagtgatgaagtacattcactataaactggcaagtgctgg
acttggaggcgatgctgcacgaatgcctctatctgcagctacaggtggagacgaaaccgatgcaccagaccccctgcaag
aagctctccaggtaacaggtactggtattggattggtttttgcacaccgaagcggagctggattgggagactgtttgcaa
tttaatgaggaaaatgcacaaacaacgtttcttcaagttgttgatgagctcttccgagatggggtaaactgggggcgcat
tgttgctttctttgagtttggtggtgttatgtgtgtggaaagcgtcaatagaggcataccctccctcgttgacaacattg
ccgcgtggatgacagaccagctgggtggagaggttggtttgtggatccaagagaacggaggatggcacacttttgagcac
atgatcaacccccctcccgaacgccacaggaacaggcgatgcaatatcttgtag
© 1998-2018