Dataset for CDS BCL2L2 of organism Mustela putorius furo

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|M3Y5X5_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L2 (length=660 residues).
aagcctgaagcaccccttctggctttccaaccatatattcacgccagcctttcatccttgactcttacagccgcccggat
ggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggttatg
tttgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttgag
acccgcttccggcgtaccttctctgatttggcagcccagctgcatgtgaccccaggctcggcccagcagcgcttcaccca
ggtctctgacgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtgtg
ctgagagtgtcaacaaagagatggagccacttgtgggccaagtgcaagagtggatggtggcctacctggagacgcggctg
gccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcg
tctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagggg
ccttttttgctagcaagtga
© 1998-2018