Dataset for CDS BCL-2-like of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

18 sequence(s)

>gnl|bcl2dbcds|D3Z5F7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaagctcgagtcagggagatggaggaagaggct
gagaagctaaaggagctacaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctggcccagtgat
catgtctcttgaggagaagatggaggctgatgcccgctctatctacgttggcaatgtggactatggtgcaacagcagaag
agctggaagcccattttcatggctgtggttcagtcaaccgtgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcggacaaagagtcagtgaggacgtccctggccttagatgagtccctgttcagaggaag
acaaatcaaggtgattcccaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccgcgctcccgatacc
gtgcccggactaccaactacaacagctcccgatctcgattctacagtggttttaacagcaggccccggggtcgaatctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|O35843_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=708 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgttgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctggggtgtgagtggaggtacacccctcagatctgtcttcagaaggcttgttcaagtgccaggagtggcggagcacgttt
gtgatcccagcctttgggaggtggaaacagaaggatcggaagttcaaggccctcctcagctattatag
>gnl|bcl2dbcds|O55177_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|O55178_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=387 residues).
atggctgagtacgagctcatgcatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcattcagagtgctacaaagagttgctttctccgttcagaaggaagttggaaagaacctaaagt
catacttggatgactttcacgtggaatccatagataccaccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaattggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaaacttccacaagagc
agattgccctggatgtacgtgcttacaaacaagtttccagttttggggcagaattcataatgaataa
>gnl|bcl2dbcds|O55179_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atgtctgagtacgagttcatgtatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccacaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatgaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|P10417_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus musculus GN=BCL-2 (length=600 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggtaggtgcatgtctggttgaatga
>gnl|bcl2dbcds|P10417_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Mus musculus GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgctggagatgcggacgcggcgcccctgggggctgcccccacccctggcatcttctccttccagcctg
agagcaacccaatgcccgctgtgcaccgggacatggctgccaggacgtctcctctcaggcccctcgttgccaccgctggg
cctgcgctcagccctgtgccacctgtggtccatctgaccctccgccgggctggggatgacttctctcgtcgctaccgtcg
tgacttcgcagagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggaac
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcacccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactatatggccccagcatgcgacctctgtttgatttctcctggctgtctc
tgaagaccctgctcagcctggccctggtcggggcctgcatcactctgggtgcatacctgggccacaagtga
>gnl|bcl2dbcds|P70345_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=537 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggtaagaagttctcaattgctgctctccgcatccctctacaaagttggt
cttcatgggaaaatagggcctctgatgggaggctggggttgtgctgggaagggctga
>gnl|bcl2dbcds|P70345_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|P70345_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=240 residues).
atggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtctggctgactggatccacagcag
tgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactggg
catcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|P97287_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus musculus GN=MCL-1 (length=858 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccgaggaccccgacgtcaccgcgtc
ggccgaaaggcggctgcataagtcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgcca
tcgtgtctccggaggaggaactggacggctgcgagccggaggccatcggcaagcgcccggccgtgctgcccctcctggag
cgcgtgagcgaggcggccaagagctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagagga
cgacctataccgccagtcgctggagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctc
tgggcgaggcgggcgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgag
acggccttccagggcatgctccggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtcca
tgttttcaaagatggcgtaacaaactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaa
agagcgtaaaccaagaaagcttcatcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactgg
cttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgct
gctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|P97287_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus musculus GN=MCL-1 (length=996 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctccggaggaggaact
ggacggctgcgagccggaggccatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctt
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
atgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgct
ggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|Q07440_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtctgagctcatgcatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccacaagagca
gattgccctggatgtatgtgcttacaaacaagtttccagttttgtggcagaattcataatgaataacacaggagaatgga
tacggcagaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|Q0P538_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=387 residues).
atggctgagtacgagctcatgcatatccactccctggctgagcactaccttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcattcagagtgctacaaagagttgctttctccgttcagaaggaagttggaaagaacctaaagt
catacttggatgactttcacgtggaatccatagataccaccagaataatattcaaccaagtgatggaaaaagagtttgaa
aatggcatcattaattggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaaacttccacaagagc
agattgccctggatgtacgtgcttacaaacaagtttccagttttggggcagaattcatcatgaataa
>gnl|bcl2dbcds|Q497M6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagcaaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|Q4FK02_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atgtctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagcaaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagttctgggaaatgctctttctcctcaagtag
>gnl|bcl2dbcds|Q8K164_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Mus musculus GN=BCL2A1 (length=519 residues).
atggctgagtacgagttcatgtatatccactccctggctgagcactatcttcagtatgtgctacaggtacccgcctttga
gtcggctccaagccaagcatgcagagtgctacaaagagttgctttctccgttcagaaggaagttgaaaagaatctgaagt
catacttggatgactttcacgtggaatccatagataccgccagaataatattcaaccaagtgatggaaaaagagtttgaa
gatggcatcattaactggggaaggattgtgactatatttgcctttgggggtgttctcctcaaaaaacttccgcaagagca
gattgccctggatgtaggtgcttacaaacaagtttccagttttgtggcagaattcataatcaataacacaggagaatgga
tacggcggaatggaggttgggaagatggcttcataaagaagtttgaacccaaatctggctggctgacttttctgcagatg
acaggacagatctgggaaatgctctttctcctcaagtaa
>gnl|bcl2dbcds|Q9Z0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mus musculus GN=BCL2L10 (length=576 residues).
atggccgactcgcaggacccactgcatgaacgcactagacggctgctgtctgactacatattcttctgcgcacgggagcc
ggacaccccagagccaccgcccacgtctgtcgaggcggccttgcttcgctctgtgactaggcagatccagcaggagcacc
aagaatttttttcctccttctgcgaaagccggggcaatcgcctggagctggtgaaacagatggcagataagttgctctcc
aaagaccaagacttcagctggagccaactggtgatgctcctggccttcgcggggacgcttatgaatcaaggcccttacat
ggctgtcaagcagaagagggatctggggaatcgtgtcatagtgacccgagactgctgtctcatagtgaactttctgtata
atctgctcatggggcgtcggcaccgcgccaggctggaggctctcggcggctgggatggcttttgccgcttcttcaagaat
cctttaccgctcggcttctggagaagattgctgattcaggcttttctgtcaggcttctttgcaacagccatcttttttat
ctggaaacgtttataa
© 1998-2018