Dataset for CDS BCL2L2 of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|D3Z5F7_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggagctagaagcgatcaaagctcgagtcagggagatggaggaagaggct
gagaagctaaaggagctacaaaacgaggtagagaagcagatgaatatgagtccacccccaggcaatgctggcccagtgat
catgtctcttgaggagaagatggaggctgatgcccgctctatctacgttggcaatgtggactatggtgcaacagcagaag
agctggaagcccattttcatggctgtggttcagtcaaccgtgttactatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcggacaaagagtcagtgaggacgtccctggccttagatgagtccctgttcagaggaag
acaaatcaaggtgattcccaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccgcgctcccgatacc
gtgcccggactaccaactacaacagctcccgatctcgattctacagtggttttaacagcaggccccggggtcgaatctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|P70345_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=240 residues).
atggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtctggctgactggatccacagcag
tgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacggcgtctgcgggaggggaactggg
catcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|P70345_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcacgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|P70345_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Mus musculus GN=BCL2L2 (length=537 residues).
atggcgaccccagcctcaaccccagacacacgggctctagtggctgactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggaaggcccagccgccgacccgctgcaccaagccatgcgggctgctggagacgagtttg
agacccgtttccgccgcaccttctctgacctggccgctcagctacacgtgaccccaggctcagcccagcaacgcttcacc
caggtttccgacgaacttttccaagggggccctaactggggccgtcttgtggcattctttgtctttggggctgccctgtg
tgctgagagtgtcaacaaagaaatggagcctttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
tggctgactggatccacagcagtgggggctgggtaagaagttctcaattgctgctctccgcatccctctacaaagttggt
cttcatgggaaaatagggcctctgatgggaggctggggttgtgctgggaagggctga
© 1998-2018