Dataset for CDS BCL2L10 of organism Mus musculus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q9Z0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mus musculus GN=BCL2L10 (length=576 residues).
atggccgactcgcaggacccactgcatgaacgcactagacggctgctgtctgactacatattcttctgcgcacgggagcc
ggacaccccagagccaccgcccacgtctgtcgaggcggccttgcttcgctctgtgactaggcagatccagcaggagcacc
aagaatttttttcctccttctgcgaaagccggggcaatcgcctggagctggtgaaacagatggcagataagttgctctcc
aaagaccaagacttcagctggagccaactggtgatgctcctggccttcgcggggacgcttatgaatcaaggcccttacat
ggctgtcaagcagaagagggatctggggaatcgtgtcatagtgacccgagactgctgtctcatagtgaactttctgtata
atctgctcatggggcgtcggcaccgcgccaggctggaggctctcggcggctgggatggcttttgccgcttcttcaagaat
cctttaccgctcggcttctggagaagattgctgattcaggcttttctgtcaggcttctttgcaacagccatcttttttat
ctggaaacgtttataa
© 1998-2018