Dataset for CDS Unclassified of organism Monodelphis domestica

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7CVK3_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Monodelphis domestica (length=420 residues).
atggcatctccagtatctactgatgtccctgctcttgcagctgattttgtacactacaaacttaaacagaaaacctatga
taacctattgggtctagaagagaacttctttgcaggtgtaccctcaagagagcctctacatttggccatgcactcttctg
gagatcaatatgaattcttctgtaacaacacgactattgatttagaccatgcaatgaagtattttaaccatgctgcagat
gaaatttttgaacaagggatcaccaggggttatatagtgggatttttctatttcagtgttgcatttggttcctgctgtat
tggttctacaaaaagttccccgattcagttagttaagaactggatggtgatttacatagagactaagttgatgaactgga
tccaccaaaatgggacatat
© 1998-2018